purification of LpxA of Chlamydia trachomatis and preparation of its polyclonal antibody.  

The expression and purification of LpxA of Chlamydia trachomatis and preparation of its polyclonal antibody.

 

The aim of this research is to purify the LpxA protein of Chlamydia trachomatis (Ct) and put together the polyclonal antibody towards LpxA protein, in order to put a basis for learning the perform of LpxA protein. The LpxA gene was amplified by PCR. The expression plasmid pET28a-LpxA was constructed by utilizing pET28a because the vector.

 

The fusion protein containing 6 histidine tag was induced by IPTG and purified by Ni2+ chromatography gel. The purified His-LpxA protein was used as an immunogen to immunize New Zealand rabbits subcutaneously via the again to arrange polyclonal antibody. Immunoblotting was used to detect the response between the antibody and His-LpxA.

The willpower of polyclonal antibody titer was detected by ELISA. The relative molecular weight of His-LpxA was 32.eight kDa, and it may very well be expressed in Escherichia coli. The purity of the purified protein was about 95%. After immunizing New Zealand rabbits, the antiserum was in a position to acknowledge the recombinant His-LpxA protein with a titer larger than 1:10240. On this research, LpxA protein was efficiently purified and antiserum was ready, which supplied an experimental foundation for learning the perform of LpxA protein.

 

Anti-MFN2 antibody
STJ112214	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified.

Anti-MFN2 antibody
STJ114644	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified.

Anti-MFN2 antibody
STJ115566	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified.

Anti-MFN2 Antibody
STJ501759	St John's Laboratory	100 µg	EUR 476

Anti-Mfn2 antibody
STJ94105	St John's Laboratory	200 µl	EUR 197
Description: Mfn2 is a protein encoded by the MFN2 gene which is approximately 86,4 kDa. Mfn2 is localised to the mitochondrion outer membrane. It is involved in pink/parkin mediated mitophagy, toll-like receptor signalling pathways and glucose / energy metabolism. It is a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mfn2 is ubiquitously expressed at low levels. Mutations in the MFN2 gene may result in Charcot-Marie-Tooth disease. STJ94105 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of Mfn2 protein.

Anti-MFN2 Antibody (Biotin)
STJ501760	St John's Laboratory	100 µg	EUR 586

Anti-MFN2 Antibody (FITC)
STJ501761	St John's Laboratory	100 µg	EUR 586

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

Anti-Mitofusin 2/MFN2 Antibody
PA1051	BosterBio	100ug/vial	EUR 294

Anti-Mitofusin 2/MFN2 Antibody
PB9265	BosterBio	100ug/vial	EUR 294

MFN2 antibody
70R-18496	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal MFN2 antibody

MFN2 antibody
70R-13734	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal MFN2 antibody

MFN2 Antibody
33015-100ul	SAB	100ul	EUR 252

MFN2 Antibody
1-CSB-PA003234	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

MFN2 Antibody
DF8106	Affbiotech	200ul	EUR 304
Description: MFN2 Antibody detects endogenous levels of total MFN2.

MFN2 Antibody
1-CSB-PA013756GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MFN2 Antibody
1-CSB-PA013756LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:3000, IHC:1:20-1:200

MFN2 Antibody
ABD8106	Lifescience Market	100 ug	EUR 438

Mfn2 Polyclonal Antibody
41141-100ul	SAB	100ul	EUR 252

Mfn2 Polyclonal Antibody
41141-50ul	SAB	50ul	EUR 187

Polyclonal MFN2 Antibody
APR08441G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MFN2 . This antibody is tested and proven to work in the following applications:

Mfn2 Polyclonal Antibody
ABP51785-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Mfn2 Applications tips:
Description: A polyclonal antibody for detection of Mfn2 from Human, Mouse, Rat. This Mfn2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mfn2

Mfn2 Polyclonal Antibody
ABP51785-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Mfn2 Applications tips:
Description: A polyclonal antibody for detection of Mfn2 from Human, Mouse, Rat. This Mfn2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mfn2

Mfn2 Polyclonal Antibody
ABP51785-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Mfn2 Applications tips:
Description: A polyclonal antibody for detection of Mfn2 from Human, Mouse, Rat. This Mfn2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mfn2

Mfn2 Polyclonal Antibody
ES2784-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Mfn2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Mfn2 Polyclonal Antibody
ES2784-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Mfn2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MFN2 siRNA
20-abx924043	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MFN2 siRNA
20-abx924044	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Mitofusin 2 (MFN2) Antibody
20-abx113830	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Mitofusin-2 (MFN2) Antibody
20-abx136081	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Mitofusin-2 (MFN2) Antibody
20-abx121952	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Mitofusin-2 (MFN2) Antibody
abx034129-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mitofusin-2 (MFN2) Antibody
abx034129-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Mfn2 Polyclonal Conjugated Antibody
C41141	SAB	100ul	EUR 397

Polyclonal MFN2 Antibody (Center)
APR08442G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MFN2 (Center). This antibody is tested and proven to work in the following applications:

MFN2 Antibody, HRP conjugated
1-CSB-PA013756LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MFN2 Antibody, FITC conjugated
1-CSB-PA013756LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MFN2 Antibody, Biotin conjugated
1-CSB-PA013756LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mitofusin-2 (MFN2) Antibody
abx235151-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody
20-abx328857	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Mitofusin 2 (MFN2) Antibody
abx448536-100ug	Abbexa	100 ug	EUR 523
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody
abx445068-100ug	Abbexa	100 ug	EUR 523
Shipped within 5-12 working days.

Mitofusin-2 (MFN2) Antibody
20-abx301797	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

MFN2 Blocking Peptide
DF8106-BP	Affbiotech	1mg	EUR 195

MFN2 Blocking Peptide
20-abx161675	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

MFN2 cloning plasmid
CSB-CL013756HU-10ug	Cusabio	10ug	EUR 747
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2274 Sequence: atgtccctgctcttctctcgatgcaactctatcgtcacagtcaagaaaaataagagacacatggctgaggtgaatgcatccccacttaagcactttgtcactgccaagaagaagatcaatggcatttttgagcagctgggggcctacatccaggagagcgccaccttccttgaag Show more
Description: A cloning plasmid for the MFN2 gene.

Mitofusion 2/MFN2
RA26001	Neuromics	100 ul	EUR 539

pCMV-SPORT6-MFN2
PVT13137	Lifescience Market	2 ug	EUR 391

Mitofusin-2 (MFN2) Antibody (HRP)
20-abx314874	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mitofusin-2 (MFN2) Antibody (FITC)
20-abx314875	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mitofusin-2 (MFN2) Antibody (Biotin)
20-abx314876	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mitofusin 2 (MFN2) Antibody (ALP)
abx446781-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (APC)
abx446782-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (PerCP)
abx446787-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (RPE)
abx446788-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (Streptavidin)
abx446789-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ALP)
abx442465-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (APC)
abx442746-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (Biotin)
abx443026-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (FITC)
abx443306-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (HRP)
abx443587-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (PerCP)
abx444149-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (RPE)
abx444430-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (Streptavidin)
abx444711-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 390)
abx446773-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 488)
abx446774-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 565)
abx446775-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 594)
abx446776-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 633)
abx446777-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 655)
abx446778-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 680)
abx446779-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 700)
abx446780-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 390)
abx440217-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 488)
abx440498-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 565)
abx440779-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 594)
abx441060-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 633)
abx441341-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 655)
abx441622-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 680)
abx441903-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 700)
abx442184-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

MFN2 ELISA KIT|Human
EF007293	Lifescience Market	96 Tests	EUR 689

Human MFN2 shRNA Plasmid
20-abx956672	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MFN2 shRNA Plasmid
20-abx980316	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCMV-SPORT6-MFN2 Plasmid
PVTB00467	Lifescience Market	2 ug	EUR 356

pCMV-HA-MFN2 Plasmid
PVTB00467-2a	Lifescience Market	2 ug	EUR 356

MFN2 Recombinant Protein (Human)
RP019252	ABM	100 ug	Ask for price

MFN2 Recombinant Protein (Mouse)
RP150413	ABM	100 ug	Ask for price

MFN2 Recombinant Protein (Rat)
RP211526	ABM	100 ug	Ask for price

Monoclonal MFN2 Antibody (monoclonal) (M03), Clone: 4H8
APR08425G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human MFN2 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 4H8. This antibody is applicable in WB and IHC, E

Monoclonal MFN2 Antibody (monoclonal) (M01), Clone: 6A8
APR08443G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human MFN2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 6A8. This antibody is applicable in WB and IHC

Mitofusin 2 (MFN2) Antibody (PE/ATTO 594)
abx446786-100ug	Abbexa	100 ug	EUR 592
Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (PE/ATTO 594)
abx443868-100ug	Abbexa	100 ug	EUR 592
Shipped within 5-12 working days.

Mfn2 ORF Vector (Rat) (pORF)
ORF070510	ABM	1.0 ug DNA	EUR 506

MFN2 ORF Vector (Human) (pORF)
ORF006418	ABM	1.0 ug DNA	EUR 95

Mfn2 ORF Vector (Mouse) (pORF)
ORF050139	ABM	1.0 ug DNA	EUR 506

MFN2 ELISA Kit (Human) (OKCD00471)
OKCD00471	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Essential transmembrane GTPase, which mediates mitochondrial fusion. Fusion of mitochondria occurs in many cell types and constitutes an important step in mitochondria morphology, which is balanced between fusion and fission. MFN2 acts independently of the cytoskeleton. It therefore plays a central role in mitochondrial metabolism and may be associated with obesity and/or apoptosis processes. Overexpression induces the formation of mitochondrial networks. Plays an important role in the regulation of vascular smooth muscle cell proliferation. Involved in the clearance of damaged mitochondria via selective autophagy (mitophagy). Is required for PARK2 recruitment to dysfunctional mitochondria. Involved in the control of unfolded protein response (UPR) upon ER stress including activation of apoptosis and autophagy during ER stress. Acts as an upstream regulator of EIF2AK3 and suppresses EIF2AK3 activation under basal conditions.5 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.2"Dysregulation of HSG triggers vascular proliferative disorders."_x005F_x005F_x000D_Chen K.-H., Guo X., Ma D., Guo Y., Li Q., Yang D., Li P., Qiu X., Wen S., Xiao R.-P., Tang J._x005F_x005F_x000D_Nat. Cell Biol. 6:872-883(2004) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), FUNCTION, DISEASE.Ref.9"Control of mitochondrial morphology by a human mitofusin."_x005F_x005F_x000D_Santel A., Fuller M.T._x005F_x005F_x000D_J. Cell Sci. 114:867-874(2001) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, MUTAGENESIS OF LYS-109; 622-GLY--VAL-624 AND 657-LYS--ARG-659.Ref.10"Membrane topology and mitochondrial targeting of mitofusins, ubiquitous mammalian homologs of the transmembrane GTPase Fzo."_x005F_x005F_x000D_Rojo M., Legros F., Chateau D., Lombes A._x005F_x005F_x000D_J. Cell Sci. 115:1663-1674(2002) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, MEMBRANE TOPOLOGY, TISSUE SPECIFICITY, MUTAGENESIS OF LYS-109; SER-110 AND ARG-259.Ref.16"MiD49 and MiD51 can act independently of Mff and Fis1 in Drp1 recruitment and are specific for mitochondrial fission."_x005F_x005F_x000D_Palmer C.S., Elgass K.D., Parton R.G., Osellame L.D., Stojanovski D., Ryan M.T._x005F_x005F_x000D_J. Biol. Chem. 288:27584-27593(2013) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.17"PINK1-phosphorylated mitofusin 2 is a Parkin receptor for culling damaged mitochondria."_x005F_x005F_x000D_Chen Y., Dorn G.W. II_x005F_x005F_x000D_Science 340:471-475(2013) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN MITOPHAGY, INTERACTION WITH PARK2, PHOSPHORYLATION AT THR-111 AND SER-442 BY PINK1, UBIQUITINATION BY PARK2, SUBCELLULAR LOCATION, MUTAGENESIS OF THR-111 AND SER-442. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

MFN2 ELISA Kit (Human) (OKEH08248)
OKEH08248	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 35pg/mL

Human Mitofusin 2 (MFN2) ELISA Kit
20-abx156904	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Mitofusin-2 (MFN2) ELISA Kit
abx257748-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Rat Mitofusin 2 (MFN2) ELISA Kit
abx259144-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Mitofusin 2 (MFN2) ELISA Kit
abx259146-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human MFN2(Mitofusin-2) ELISA Kit
EH4039	FN Test	96T	EUR 524.1
Detection range: 31.25-2000 pg/ml Alias: Mitofusin-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Mitofusin- 2, MFN2 ELISA KIT
ELI-16285h	Lifescience Market	96 Tests	EUR 824

Rat Mitofusin- 2, Mfn2 ELISA KIT
ELI-23089r	Lifescience Market	96 Tests	EUR 886

Mouse Mitofusin- 2, Mfn2 ELISA KIT
ELI-31284m	Lifescience Market	96 Tests	EUR 865

Human Mitofusin 2 (MFN2) CLIA Kit
20-abx494957	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mfn2 sgRNA CRISPR Lentivector set (Rat)
K7541801	ABM	3 x 1.0 ug	EUR 339

MFN2 sgRNA CRISPR Lentivector set (Human)
K1296501	ABM	3 x 1.0 ug	EUR 339

Mfn2 sgRNA CRISPR Lentivector set (Mouse)
K3805401	ABM	3 x 1.0 ug	EUR 339

Human Mitofusin 2 ELISA Kit (MFN2)
RK01841	Abclonal	96 Tests	EUR 521

Human Mitofusin 2 (MFN2) ELISA Kit
SEF591Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mitofusin 2 (MFN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mitofusin 2 (MFN2) in tissue homogenates, cell lysates and other biological fluids.

Human Mitofusin 2 (MFN2) ELISA Kit
SEF591Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mitofusin 2 (MFN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mitofusin 2 (MFN2) in tissue homogenates, cell lysates and other biological fluids.

Human Mitofusin 2 (MFN2) ELISA Kit
SEF591Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mitofusin 2 (MFN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mitofusin 2 (MFN2) in tissue homogenates, cell lysates and other biological fluids.

Human Mitofusin 2 (MFN2) ELISA Kit
SEF591Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mitofusin 2 (MFN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mitofusin 2 (MFN2) in tissue homogenates, cell lysates and other biological fluids.

Human Mitofusin 2 (MFN2) ELISA Kit
4-SEF591Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Mitofusin 2 elisa. Alternative names of the recognized antigen: CMT2A CMT2A2 CPRP1 HSG MARF Transmembrane GTPase MFN2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Mitofusin 2 (MFN2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human MFN2 (Mitofusin 2)
ELK5212	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Mitofusin 2 (MFN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mitofusin 2 (MF Show more
Description: A sandwich ELISA kit for detection of Mitofusin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Mitofusin-2 (MFN2)
KTE100625-48T	Abbkine	48T	EUR 332
MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat Show more
Description: Quantitative sandwich ELISA for measuring Rat Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Mitofusin-2 (MFN2)
KTE100625-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat Show more
Description: Quantitative sandwich ELISA for measuring Rat Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Mitofusin-2 (MFN2)
KTE100625-96T	Abbkine	96T	EUR 539
MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat Show more
Description: Quantitative sandwich ELISA for measuring Rat Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mfn2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7541802	ABM	1.0 ug DNA	EUR 154

Mfn2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7541803	ABM	1.0 ug DNA	EUR 154

Mfn2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7541804	ABM	1.0 ug DNA	EUR 154

MFN2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1296502	ABM	1.0 ug DNA	EUR 154

MFN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1296503	ABM	1.0 ug DNA	EUR 154

MFN2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1296504	ABM	1.0 ug DNA	EUR 154

Mfn2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3805402	ABM	1.0 ug DNA	EUR 154

Mfn2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3805403	ABM	1.0 ug DNA	EUR 154

Mfn2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3805404	ABM	1.0 ug DNA	EUR 154

ELISA kit for Mouse Mitofusin-2 (MFN2)
KTE71041-48T	Abbkine	48T	EUR 332
MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell prolifera Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mitofusin-2 (MFN2)
KTE71041-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell prolifera Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mitofusin-2 (MFN2)
KTE71041-96T	Abbkine	96T	EUR 539
MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell prolifera Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mitofusin-2 (MFN2)
KTE61636-48T	Abbkine	48T	EUR 332
MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat Show more
Description: Quantitative sandwich ELISA for measuring Human Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mitofusin-2 (MFN2)
KTE61636-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat Show more
Description: Quantitative sandwich ELISA for measuring Human Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mitofusin-2 (MFN2)
KTE61636-96T	Abbkine	96T	EUR 539
MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat Show more
Description: Quantitative sandwich ELISA for measuring Human Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MFN2 Protein Vector (Mouse) (pPB-C-His)
PV200554	ABM	500 ng	EUR 1065

MFN2 Protein Vector (Mouse) (pPB-N-His)
PV200555	ABM	500 ng	EUR 1065

MFN2 Protein Vector (Mouse) (pPM-C-HA)
PV200556	ABM	500 ng	EUR 1065

MFN2 Protein Vector (Mouse) (pPM-C-His)
PV200557	ABM	500 ng	EUR 1065

MFN2 Protein Vector (Rat) (pPB-C-His)
PV282038	ABM	500 ng	EUR 1166

MFN2 Protein Vector (Rat) (pPB-N-His)
PV282039	ABM	500 ng	EUR 1166

MFN2 Protein Vector (Rat) (pPM-C-HA)
PV282040	ABM	500 ng	EUR 1166

MFN2 Protein Vector (Rat) (pPM-C-His)
PV282041	ABM	500 ng	EUR 1166

MFN2 Protein Vector (Human) (pPB-C-His)
PV025669	ABM	500 ng	EUR 329

MFN2 Protein Vector (Human) (pPB-N-His)
PV025670	ABM	500 ng	EUR 329

MFN2 Protein Vector (Human) (pPM-C-HA)
PV025671	ABM	500 ng	EUR 329

MFN2 Protein Vector (Human) (pPM-C-His)
PV025672	ABM	500 ng	EUR 329

Mfn2 3'UTR Luciferase Stable Cell Line
TU113146	ABM	1.0 ml	Ask for price

Mfn2 3'UTR GFP Stable Cell Line
TU163146	ABM	1.0 ml	Ask for price

Mfn2 3'UTR Luciferase Stable Cell Line
TU213112	ABM	1.0 ml	Ask for price

Mfn2 3'UTR GFP Stable Cell Line
TU263112	ABM	1.0 ml	Ask for price

MFN2 3'UTR GFP Stable Cell Line
TU063296	ABM	1.0 ml	EUR 1521

MFN2 3'UTR Luciferase Stable Cell Line
TU013296	ABM	1.0 ml	EUR 1521

Mfn2 ELISA Kit| Rat Mitofusin-2 ELISA Kit
EF018980	Lifescience Market	96 Tests	EUR 689

Mfn2 ELISA Kit| Mouse Mitofusin-2 ELISA Kit
EF015539	Lifescience Market	96 Tests	EUR 689

MFN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV666283	ABM	1.0 ug DNA	EUR 1355

MFN2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV666287	ABM	1.0 ug DNA	EUR 1355

MFN2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV666288	ABM	1.0 ug DNA	EUR 1355

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7541805	ABM	3 x 1.0 ug	EUR 376

MFN2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1296505	ABM	3 x 1.0 ug	EUR 376

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3805405	ABM	3 x 1.0 ug	EUR 376

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7541806	ABM	1.0 ug DNA	EUR 167

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7541807	ABM	1.0 ug DNA	EUR 167

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7541808	ABM	1.0 ug DNA	EUR 167

MFN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV666284	ABM	1.0 ug DNA	EUR 1355

MFN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV666285	ABM	1.0 ug DNA	EUR 1413

MFN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV666286	ABM	1.0 ug DNA	EUR 1413

MFN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1296506	ABM	1.0 ug DNA	EUR 167

MFN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1296507	ABM	1.0 ug DNA	EUR 167

MFN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1296508	ABM	1.0 ug DNA	EUR 167

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3805406	ABM	1.0 ug DNA	EUR 167

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3805407	ABM	1.0 ug DNA	EUR 167

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3805408	ABM	1.0 ug DNA	EUR 167

Anti-Anti-SEPT6 antibody antibody
STJ11100949	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody
STJ111369	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody
STJ111530	St John's Laboratory	100 µl	EUR 277

 

Efficiency analysis of the polyclonal anti-rabies virus ribonucleoprotein IgG antibodies produced in-house to be used in direct fluorescent antibody check.

 

Fluorescein isothiocyanate (FITC) labelled anti-rabies virus ribonucleoprotein (RNP) antibodies can be utilized as immunoreagents in direct fluorescent antibody testing (dFAT) for rabies diagnoses. Whereas in-house merchandise are sometimes utilized by laboratories, most conjugates are business reagents. Business anti-RNP antibodies are solely accessible for analysis functions in Brazil, nevertheless, which contributes to the rising use of in-house produced antibodies.

 

Contemplating that conjugate high quality might affect the outcomes obtained throughout rabies analysis, we sought to investigate the efficiency necessities of in-house produced polyclonal anti-RNP IgG-FITC for utility in dFAT. To that finish, their reproducibility, diagnostic sensitivity, and specificity have been evaluated. The titer of polyclonal anti-RNP IgG-FITC was initially decided and evaluated by dFAT, utilizing central nervous system (CNS) samples of various animal species (canines, cats, bovines, equines, bats, and non-human primates).

 

As our predominant end result, the polyclonal anti-RNP IgG-FITC reached a titer of 1:30/1:40 in dFAT, with 100% of diagnostic sensitivity and specificity. When it comes to reproducibility, the antibodies, regardless the manufacturing batch, introduced the identical performances. In conclusion, the in-house produced polyclonal anti-RNP IgG-FITC proved appropriate for rabies virus antigen detection by dFAT.

 

Manufacturing of F(ab’)2 from Monoclonal and Polyclonal Antibodies.

 

Antibodies are broadly utilized in therapeutic, diagnostic, and analysis purposes, and antibody derivatives reminiscent of F(ab’)₂ fragments are used when solely a specific antibody area is required. F(ab’)₂ will be produced via antibody engineering, however some purposes require F(ab’)₂ produced from an authentic formulated antibody or instantly from a polyclonal antibody pool.

The cysteine protease immunoglobulin-degrading enzyme (IdeS) from Streptococcus pyogenes digests immunoglobulin G (IgG) particularly and effectively to supply F(ab’)₂ . Right here we element the manufacturing and purification of recombinant IdeS; its utilization to digest monoclonal or polyclonal antibodies to F(ab’)₂ fragments; and F(ab’)₂ purification via consecutive affinity chromatography steps.

The resultant F(ab’)₂ exhibit excessive purity, retain antigen-binding performance, and are readily utilizable in numerous downstream purposes. © 2020 by John Wiley & Sons, Inc. Primary Protocol: Manufacturing and purification of F(ab’)₂ fragments from monoclonal and polyclonal antibodies utilizing IdeS Alternate Protocol: Purification of polyclonal antigen-specific F(ab’)₂ fragments from human serum or secretions Help Protocol: Manufacturing and purification of IdeS.

 

Analysis of liquid and powdered types of polyclonal antibody preparation towards Streptococcus bovis and Fusobacterium necrophorum in cattle tailored or not tailored to extremely fermentable carbohydrate diets.

 

Feed components that modify rumen fermentation can be utilized to forestall metabolic disturbances reminiscent of acidosis and optimize beef cattle manufacturing. The research evaluated the consequences of liquid and powdered types of polyclonal antibody preparation (PAP) towards Streptococcus bovis and Fusobacterium necrophorum on rumen fermentation parameters in ruminally cannulated non-lactating dairy cows that have been tailored or unadapted to a excessive focus weight-reduction plan.

A double 3 × Three Latin sq. design was used with three PAP therapies (management, powdered and liquid PAP) and two adaptation protocols (tailored, unadapted; utilized to the sq.). Tailored animals have been transitioned for two weeks from an all-forage to an 80% focus weight-reduction plan, whereas unadapted animals have been switched abruptly.

 

Interactions between sampling time and adaptation have been noticed; 12 h after feeding, the tailored group had decrease ruminal pH and larger complete brief chain fatty acid concentrations than the unadapted group, whereas the alternative was noticed after 24 h. Acetate:propionate ratio, molar proportion of butyrate and ammonia nitrogen focus have been typically larger in tailored than unadapted cattle as much as 36 h after feeding.

 

Adaptation promoted 3.5 instances the variety of Entodinium protozoa however copy numbers of S. bovis and Fibrobacter succinogens genes in rumen fluid weren’t affected. Nonetheless, neither liquid nor powdered types of PAP altered rumen acidosis variables in tailored or unadapted animals.Adaptation of cattle to extremely fermentable carbohydrate diets promoted a extra secure ruminal setting, however PAP was not efficient on this research by which no animal skilled acute or sub-acute rumen acidosis.

Anti-DNMT3A antibody
PAab02484	Lifescience Market	100 ug	EUR 355

Anti-DNMT3A antibody
PAab02485	Lifescience Market	100 ug	EUR 355

Anti-DNMT3A antibody
STJ28586	St John's Laboratory	100 µl	EUR 277
Description: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase that is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes to the cytoplasm and nucleus and its expression is developmentally regulated.

Anti-DNMT3A antibody
STJ23412	St John's Laboratory	100 µl	EUR 277
Description: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase that is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes to the cytoplasm and nucleus and its expression is developmentally regulated.

Anti-DNMT3A antibody
STJ23413	St John's Laboratory	100 µl	EUR 277
Description: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase that is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes to the cytoplasm and nucleus and its expression is developmentally regulated.

Anti-DNMT3A antibody
STJ113373	St John's Laboratory	100 µl	EUR 277
Description: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase that is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes to the cytoplasm and nucleus and its expression is developmentally regulated.

Anti-DNMT3A antibody
STJ119211	St John's Laboratory	100 µl	EUR 277

anti-Dnmt3a
YF-PA11403	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Dnmt3a

anti-Dnmt3a
YF-PA11404	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to Dnmt3a

anti-Dnmt3a
YF-PA11405	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Dnmt3a

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
DLR-DNMT3A-Hu-48T	DL Develop	48T	EUR 517
Should the Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3A (DNMT3A) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
DLR-DNMT3A-Hu-96T	DL Develop	96T	EUR 673
Should the Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3A (DNMT3A) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
RDR-DNMT3A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
RDR-DNMT3A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
RD-DNMT3A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
RD-DNMT3A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

Anti-Dnmt3a Rabbit Monoclonal Antibody
M00136	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Dnmt3a Antibody. Validated in IF, WB and tested in Human, Rat.

Anti-DiMethyl-DNMT3A-K44 antibody
STJ118467	St John's Laboratory	100 µl	EUR 393

DNMT3A Antibody
ABD6795	Lifescience Market	100 ug	EUR 438

DNMT3A Antibody
ABD7226	Lifescience Market	100 ug	EUR 438

DNMT3A antibody
38611-100ul	SAB	100ul	EUR 252

DNMT3A antibody
38966-100ul	SAB	100ul	EUR 252

Dnmt3a Antibody
48869-100ul	SAB	100ul	EUR 333

Dnmt3a Antibody
48869-50ul	SAB	50ul	EUR 239

DNMT3a Antibody
3227-100	Biovision		EUR 349

DNMT3a Antibody
3227-30T	Biovision		EUR 146

DNMT3A Antibody
32580-100ul	SAB	100ul	EUR 252

DNMT3A antibody
70R-16903	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DNMT3A antibody

DNMT3A Antibody
DF6795	Affbiotech	200ul	EUR 304
Description: DNMT3A Antibody detects endogenous levels of total DNMT3A.

DNMT3A Antibody
DF7226	Affbiotech	200ul	EUR 304
Description: DNMT3A Antibody detects endogenous levels of total DNMT3A.

DNMT3A Antibody
1-CSB-PA007083GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

DNMT3A Antibody
1-CSB-PA007083LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

DNMT3A Antibody
1-CSB-PA632606	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

DNMT3A Antibody
1-CSB-PA522891	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

DNMT3A Antibody
1-CSB-PA094007	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:100-1:300

DNMT3A Antibody
1-CSB-PA045919	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

Anti-Dnmt3a (mouse) Monoclonal Antibody (64B1446)
M00136-1	BosterBio	100ug	EUR 446
Description: Mouse Monoclonal Dnmt3a (mouse) Antibody (64B1446). Validated in IP, IF, IHC, WB and tested in Mouse.

Dnmt3a Conjugated Antibody
C48869	SAB	100ul	EUR 397

DNMT3A Conjugated Antibody
C32580	SAB	100ul	EUR 397

DNMT3A Polyclonal Antibody
A-1003	EpiGentek	100 µl	EUR 616.95
Description: kits suitable for this type of research

DNMT3A Polyclonal Antibody
A52569	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

DNMT3A polyclonal antibody
6849-25	Biovision		EUR 370

Dnmt3a/ Rat Dnmt3a ELISA Kit
ELI-09442r	Lifescience Market	96 Tests	EUR 886

DNMT3A siRNA
20-abx901552	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DNMT3A Protein
E11000	EpiGentek	10 µg	EUR 809.8
Description: fast delivery possible

DNMT3A siRNA
20-abx914453	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DNMT3A siRNA
20-abx914454	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pEGFP- DNMT3A
PVT10312	Lifescience Market	2 ug	EUR 266

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC551898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF555 conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC551898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF555 conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC611898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF660R conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC611898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF660R conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC401898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF640R conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC401898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF640R conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC431898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF543 conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC431898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF543 conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC471898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF647 conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC471898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF647 conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC051898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF405M conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC051898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF405M conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC041898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF405S conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC041898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF405S conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNUB1898-100	Biotium	100uL	EUR 264
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Concentration: 0.2mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNUB1898-50	Biotium	50uL	EUR 405
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), 1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNUB1898-500	Biotium	500uL	EUR 513
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Concentration: 0.2mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC681898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF568 conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC681898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF568 conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC701898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF770 conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC701898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF770 conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC881898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF488A conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC881898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF488A conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC941898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF594 conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC941898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF594 conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCB1898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Biotin conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCB1898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Biotin conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCH1898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCH1898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC801898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF680 conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC801898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF680 conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCP1898-250	Biotium	250uL	EUR 394
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), PerCP conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCR1898-250	Biotium	250uL	EUR 394
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), RPE conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCA1898-250	Biotium	250uL	EUR 394
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), APC conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCAP1898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCAP1898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC811898-100	Biotium	100uL	EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF680R conjugate, Concentration: 0.1mg/mL

DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC811898-500	Biotium	500uL	EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF680R conjugate, Concentration: 0.1mg/mL

DNMT3A Antibody, HRP conjugated
1-CSB-PA007083LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DNMT3A Antibody, FITC conjugated
1-CSB-PA007083LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DNMT3A Antibody, Biotin conjugated
1-CSB-PA007083LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA