The expression and purification of LpxA of Chlamydia trachomatis and preparation of its polyclonal antibody.
The aim of this research is to purify the LpxA protein of Chlamydia trachomatis (Ct) and put together the polyclonal antibody towards LpxA protein, in order to put a basis for learning the perform of LpxA protein. The LpxA gene was amplified by PCR. The expression plasmid pET28a-LpxA was constructed by utilizing pET28a because the vector.
The fusion protein containing 6 histidine tag was induced by IPTG and purified by Ni2+ chromatography gel. The purified His-LpxA protein was used as an immunogen to immunize New Zealand rabbits subcutaneously via the again to arrange polyclonal antibody. Immunoblotting was used to detect the response between the antibody and His-LpxA.
The willpower of polyclonal antibody titer was detected by ELISA. The relative molecular weight of His-LpxA was 32.eight kDa, and it may very well be expressed in Escherichia coli. The purity of the purified protein was about 95%. After immunizing New Zealand rabbits, the antiserum was in a position to acknowledge the recombinant His-LpxA protein with a titer larger than 1:10240. On this research, LpxA protein was efficiently purified and antiserum was ready, which supplied an experimental foundation for learning the perform of LpxA protein.

i-dna
Anti-MFN2 antibody |
STJ112214 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified. |
Anti-MFN2 antibody |
STJ114644 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified. |
Anti-MFN2 antibody |
STJ115566 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified. |
Anti-Mfn2 antibody |
STJ94105 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Mfn2 is a protein encoded by the MFN2 gene which is approximately 86,4 kDa. Mfn2 is localised to the mitochondrion outer membrane. It is involved in pink/parkin mediated mitophagy, toll-like receptor signalling pathways and glucose / energy metabolism. It is a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mfn2 is ubiquitously expressed at low levels. Mutations in the MFN2 gene may result in Charcot-Marie-Tooth disease. STJ94105 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of Mfn2 protein. |
Rabbit Polyclonal antibody Anti-CRBN |
Anti-CRBN |
ImmunoStep |
50 µg |
EUR 349 |
Anti-Mitofusin 2/MFN2 Antibody |
PA1051 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-Mitofusin 2/MFN2 Antibody |
PB9265 |
BosterBio |
100ug/vial |
EUR 294 |
MFN2 antibody |
70R-18496 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MFN2 antibody |
MFN2 antibody |
70R-13734 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Rabbit polyclonal MFN2 antibody |
MFN2 Antibody |
33015-100ul |
SAB |
100ul |
EUR 252 |
MFN2 Antibody |
1-CSB-PA003234 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000 |
MFN2 Antibody |
DF8106 |
Affbiotech |
200ul |
EUR 304 |
Description: MFN2 Antibody detects endogenous levels of total MFN2. |
MFN2 Antibody |
1-CSB-PA013756GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
MFN2 Antibody |
1-CSB-PA013756LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:3000, IHC:1:20-1:200 |
Mfn2 Polyclonal Antibody |
41141-100ul |
SAB |
100ul |
EUR 252 |
Mfn2 Polyclonal Antibody |
41141-50ul |
SAB |
50ul |
EUR 187 |
Polyclonal MFN2 Antibody |
APR08441G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MFN2 . This antibody is tested and proven to work in the following applications: |
Mfn2 Polyclonal Antibody |
ABP51785-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Mfn2
- Applications tips:
|
Description: A polyclonal antibody for detection of Mfn2 from Human, Mouse, Rat. This Mfn2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mfn2 |
Mfn2 Polyclonal Antibody |
ABP51785-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Mfn2
- Applications tips:
|
Description: A polyclonal antibody for detection of Mfn2 from Human, Mouse, Rat. This Mfn2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mfn2 |
Mfn2 Polyclonal Antibody |
ABP51785-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Mfn2
- Applications tips:
|
Description: A polyclonal antibody for detection of Mfn2 from Human, Mouse, Rat. This Mfn2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mfn2 |
Mfn2 Polyclonal Antibody |
ES2784-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Mfn2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Mfn2 Polyclonal Antibody |
ES2784-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Mfn2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
MFN2 siRNA |
20-abx924043 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MFN2 siRNA |
20-abx924044 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mitofusin 2 (MFN2) Antibody |
20-abx113830 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mitofusin-2 (MFN2) Antibody |
20-abx136081 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Mitofusin-2 (MFN2) Antibody |
20-abx121952 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Mitofusin-2 (MFN2) Antibody |
abx034129-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Mitofusin-2 (MFN2) Antibody |
abx034129-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Mfn2 Polyclonal Conjugated Antibody |
C41141 |
SAB |
100ul |
EUR 397 |
Polyclonal MFN2 Antibody (Center) |
APR08442G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MFN2 (Center). This antibody is tested and proven to work in the following applications: |
MFN2 Antibody, HRP conjugated |
1-CSB-PA013756LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MFN2 Antibody, FITC conjugated |
1-CSB-PA013756LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MFN2 Antibody, Biotin conjugated |
1-CSB-PA013756LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Mitofusin-2 (MFN2) Antibody |
abx235151-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody |
20-abx328857 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mitofusin 2 (MFN2) Antibody |
abx448536-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody |
abx445068-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
Mitofusin-2 (MFN2) Antibody |
20-abx301797 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Polyclonal Goat anti-GST α-form |
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST μ-form |
GST-ANTI-2 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST p-form |
GST-ANTI-3 |
Detroit R&D |
50 uL |
EUR 280 |
MFN2 Blocking Peptide |
DF8106-BP |
Affbiotech |
1mg |
EUR 195 |
MFN2 Blocking Peptide |
20-abx161675 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MFN2 cloning plasmid |
CSB-CL013756HU-10ug |
Cusabio |
10ug |
EUR 747 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2274
- Sequence: atgtccctgctcttctctcgatgcaactctatcgtcacagtcaagaaaaataagagacacatggctgaggtgaatgcatccccacttaagcactttgtcactgccaagaagaagatcaatggcatttttgagcagctgggggcctacatccaggagagcgccaccttccttgaag
- Show more
|
Description: A cloning plasmid for the MFN2 gene. |
Mitofusion 2/MFN2 |
RA26001 |
Neuromics |
100 ul |
EUR 539 |
Mitofusin-2 (MFN2) Antibody (HRP) |
20-abx314874 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mitofusin-2 (MFN2) Antibody (FITC) |
20-abx314875 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mitofusin-2 (MFN2) Antibody (Biotin) |
20-abx314876 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mitofusin 2 (MFN2) Antibody (ALP) |
abx446781-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (APC) |
abx446782-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (PerCP) |
abx446787-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (RPE) |
abx446788-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (Streptavidin) |
abx446789-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ALP) |
abx442465-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (APC) |
abx442746-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (Biotin) |
abx443026-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (FITC) |
abx443306-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (HRP) |
abx443587-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (PerCP) |
abx444149-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (RPE) |
abx444430-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (Streptavidin) |
abx444711-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 390) |
abx446773-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 488) |
abx446774-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 565) |
abx446775-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 594) |
abx446776-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 633) |
abx446777-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 655) |
abx446778-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 680) |
abx446779-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 700) |
abx446780-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 390) |
abx440217-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 488) |
abx440498-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 565) |
abx440779-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 594) |
abx441060-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 633) |
abx441341-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 655) |
abx441622-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 680) |
abx441903-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (ATTO 700) |
abx442184-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Human MFN2 shRNA Plasmid |
20-abx956672 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MFN2 shRNA Plasmid |
20-abx980316 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MFN2 Recombinant Protein (Human) |
RP019252 |
ABM |
100 ug |
Ask for price |
MFN2 Recombinant Protein (Mouse) |
RP150413 |
ABM |
100 ug |
Ask for price |
MFN2 Recombinant Protein (Rat) |
RP211526 |
ABM |
100 ug |
Ask for price |
Monoclonal MFN2 Antibody (monoclonal) (M03), Clone: 4H8 |
APR08425G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human MFN2 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 4H8. This antibody is applicable in WB and IHC, E |
Monoclonal MFN2 Antibody (monoclonal) (M01), Clone: 6A8 |
APR08443G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human MFN2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 6A8. This antibody is applicable in WB and IHC |
Mitofusin 2 (MFN2) Antibody (PE/ATTO 594) |
abx446786-100ug |
Abbexa |
100 ug |
EUR 592 |
- Shipped within 5-12 working days.
|
Mitofusin 2 (MFN2) Antibody (PE/ATTO 594) |
abx443868-100ug |
Abbexa |
100 ug |
EUR 592 |
- Shipped within 5-12 working days.
|
Mfn2 ORF Vector (Rat) (pORF) |
ORF070510 |
ABM |
1.0 ug DNA |
EUR 506 |
MFN2 ORF Vector (Human) (pORF) |
ORF006418 |
ABM |
1.0 ug DNA |
EUR 95 |
Mfn2 ORF Vector (Mouse) (pORF) |
ORF050139 |
ABM |
1.0 ug DNA |
EUR 506 |
MFN2 ELISA Kit (Human) (OKCD00471) |
OKCD00471 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Essential transmembrane GTPase, which mediates mitochondrial fusion. Fusion of mitochondria occurs in many cell types and constitutes an important step in mitochondria morphology, which is balanced between fusion and fission. MFN2 acts independently of the cytoskeleton. It therefore plays a central role in mitochondrial metabolism and may be associated with obesity and/or apoptosis processes. Overexpression induces the formation of mitochondrial networks. Plays an important role in the regulation of vascular smooth muscle cell proliferation. Involved in the clearance of damaged mitochondria via selective autophagy (mitophagy). Is required for PARK2 recruitment to dysfunctional mitochondria. Involved in the control of unfolded protein response (UPR) upon ER stress including activation of apoptosis and autophagy during ER stress. Acts as an upstream regulator of EIF2AK3 and suppresses EIF2AK3 activation under basal conditions.5 Publications
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.2"Dysregulation of HSG triggers vascular proliferative disorders."_x005F_x005F_x000D_Chen K.-H., Guo X., Ma D., Guo Y., Li Q., Yang D., Li P., Qiu X., Wen S., Xiao R.-P., Tang J._x005F_x005F_x000D_Nat. Cell Biol. 6:872-883(2004) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), FUNCTION, DISEASE.Ref.9"Control of mitochondrial morphology by a human mitofusin."_x005F_x005F_x000D_Santel A., Fuller M.T._x005F_x005F_x000D_J. Cell Sci. 114:867-874(2001) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, MUTAGENESIS OF LYS-109; 622-GLY--VAL-624 AND 657-LYS--ARG-659.Ref.10"Membrane topology and mitochondrial targeting of mitofusins, ubiquitous mammalian homologs of the transmembrane GTPase Fzo."_x005F_x005F_x000D_Rojo M., Legros F., Chateau D., Lombes A._x005F_x005F_x000D_J. Cell Sci. 115:1663-1674(2002) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, MEMBRANE TOPOLOGY, TISSUE SPECIFICITY, MUTAGENESIS OF LYS-109; SER-110 AND ARG-259.Ref.16"MiD49 and MiD51 can act independently of Mff and Fis1 in Drp1 recruitment and are specific for mitochondrial fission."_x005F_x005F_x000D_Palmer C.S., Elgass K.D., Parton R.G., Osellame L.D., Stojanovski D., Ryan M.T._x005F_x005F_x000D_J. Biol. Chem. 288:27584-27593(2013) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.17"PINK1-phosphorylated mitofusin 2 is a Parkin receptor for culling damaged mitochondria."_x005F_x005F_x000D_Chen Y., Dorn G.W. II_x005F_x005F_x000D_Science 340:471-475(2013) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN MITOPHAGY, INTERACTION WITH PARK2, PHOSPHORYLATION AT THR-111 AND SER-442 BY PINK1, UBIQUITINATION BY PARK2, SUBCELLULAR LOCATION, MUTAGENESIS OF THR-111 AND SER-442. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL |
MFN2 ELISA Kit (Human) (OKEH08248) |
OKEH08248 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 35pg/mL |
Human Mitofusin 2 (MFN2) ELISA Kit |
20-abx156904 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Mitofusin-2 (MFN2) ELISA Kit |
abx257748-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
Rat Mitofusin 2 (MFN2) ELISA Kit |
abx259144-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Mitofusin 2 (MFN2) ELISA Kit |
abx259146-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human MFN2(Mitofusin-2) ELISA Kit |
EH4039 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 31.25-2000 pg/ml
- Alias: Mitofusin-2
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human Mitofusin 2 (MFN2) CLIA Kit |
20-abx494957 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mfn2 sgRNA CRISPR Lentivector set (Rat) |
K7541801 |
ABM |
3 x 1.0 ug |
EUR 339 |
MFN2 sgRNA CRISPR Lentivector set (Human) |
K1296501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mfn2 sgRNA CRISPR Lentivector set (Mouse) |
K3805401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Mitofusin 2 ELISA Kit (MFN2) |
RK01841 |
Abclonal |
96 Tests |
EUR 521 |
Human Mitofusin 2 (MFN2) ELISA Kit |
SEF591Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mitofusin 2 (MFN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mitofusin 2 (MFN2) in tissue homogenates, cell lysates and other biological fluids. |
Human Mitofusin 2 (MFN2) ELISA Kit |
SEF591Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mitofusin 2 (MFN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mitofusin 2 (MFN2) in tissue homogenates, cell lysates and other biological fluids. |
Human Mitofusin 2 (MFN2) ELISA Kit |
SEF591Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mitofusin 2 (MFN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mitofusin 2 (MFN2) in tissue homogenates, cell lysates and other biological fluids. |
Human Mitofusin 2 (MFN2) ELISA Kit |
SEF591Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mitofusin 2 (MFN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mitofusin 2 (MFN2) in tissue homogenates, cell lysates and other biological fluids. |
Human Mitofusin 2 (MFN2) ELISA Kit |
4-SEF591Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Mitofusin 2 elisa. Alternative names of the recognized antigen: CMT2A
- CMT2A2
- CPRP1
- HSG
- MARF
- Transmembrane GTPase MFN2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Mitofusin 2 (MFN2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human MFN2 (Mitofusin 2) |
ELK5212 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Mitofusin 2 (MFN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mitofusin 2 (MF
- Show more
|
Description: A sandwich ELISA kit for detection of Mitofusin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Rat Mitofusin-2 (MFN2) |
KTE100625-48T |
Abbkine |
48T |
EUR 332 |
- MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Mitofusin-2 (MFN2) |
KTE100625-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Mitofusin-2 (MFN2) |
KTE100625-96T |
Abbkine |
96T |
EUR 539 |
- MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mfn2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7541802 |
ABM |
1.0 ug DNA |
EUR 154 |
Mfn2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7541803 |
ABM |
1.0 ug DNA |
EUR 154 |
Mfn2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7541804 |
ABM |
1.0 ug DNA |
EUR 154 |
MFN2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1296502 |
ABM |
1.0 ug DNA |
EUR 154 |
MFN2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1296503 |
ABM |
1.0 ug DNA |
EUR 154 |
MFN2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1296504 |
ABM |
1.0 ug DNA |
EUR 154 |
Mfn2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3805402 |
ABM |
1.0 ug DNA |
EUR 154 |
Mfn2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3805403 |
ABM |
1.0 ug DNA |
EUR 154 |
Mfn2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3805404 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Mouse Mitofusin-2 (MFN2) |
KTE71041-48T |
Abbkine |
48T |
EUR 332 |
- MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell prolifera
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Mitofusin-2 (MFN2) |
KTE71041-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell prolifera
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Mitofusin-2 (MFN2) |
KTE71041-96T |
Abbkine |
96T |
EUR 539 |
- MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell prolifera
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Mitofusin-2 (MFN2) |
KTE61636-48T |
Abbkine |
48T |
EUR 332 |
- MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Mitofusin-2 (MFN2) |
KTE61636-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Mitofusin-2 (MFN2) |
KTE61636-96T |
Abbkine |
96T |
EUR 539 |
- MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
MFN2 Protein Vector (Mouse) (pPB-C-His) |
PV200554 |
ABM |
500 ng |
EUR 1065 |
MFN2 Protein Vector (Mouse) (pPB-N-His) |
PV200555 |
ABM |
500 ng |
EUR 1065 |
MFN2 Protein Vector (Mouse) (pPM-C-HA) |
PV200556 |
ABM |
500 ng |
EUR 1065 |
MFN2 Protein Vector (Mouse) (pPM-C-His) |
PV200557 |
ABM |
500 ng |
EUR 1065 |
MFN2 Protein Vector (Rat) (pPB-C-His) |
PV282038 |
ABM |
500 ng |
EUR 1166 |
MFN2 Protein Vector (Rat) (pPB-N-His) |
PV282039 |
ABM |
500 ng |
EUR 1166 |
MFN2 Protein Vector (Rat) (pPM-C-HA) |
PV282040 |
ABM |
500 ng |
EUR 1166 |
MFN2 Protein Vector (Rat) (pPM-C-His) |
PV282041 |
ABM |
500 ng |
EUR 1166 |
MFN2 Protein Vector (Human) (pPB-C-His) |
PV025669 |
ABM |
500 ng |
EUR 329 |
MFN2 Protein Vector (Human) (pPB-N-His) |
PV025670 |
ABM |
500 ng |
EUR 329 |
MFN2 Protein Vector (Human) (pPM-C-HA) |
PV025671 |
ABM |
500 ng |
EUR 329 |
MFN2 Protein Vector (Human) (pPM-C-His) |
PV025672 |
ABM |
500 ng |
EUR 329 |
Mfn2 3'UTR Luciferase Stable Cell Line |
TU113146 |
ABM |
1.0 ml |
Ask for price |
Mfn2 3'UTR GFP Stable Cell Line |
TU163146 |
ABM |
1.0 ml |
Ask for price |
Mfn2 3'UTR Luciferase Stable Cell Line |
TU213112 |
ABM |
1.0 ml |
Ask for price |
Mfn2 3'UTR GFP Stable Cell Line |
TU263112 |
ABM |
1.0 ml |
Ask for price |
MFN2 3'UTR GFP Stable Cell Line |
TU063296 |
ABM |
1.0 ml |
EUR 1521 |
MFN2 3'UTR Luciferase Stable Cell Line |
TU013296 |
ABM |
1.0 ml |
EUR 1521 |
MFN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV666283 |
ABM |
1.0 ug DNA |
EUR 1355 |
MFN2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV666287 |
ABM |
1.0 ug DNA |
EUR 1355 |
MFN2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV666288 |
ABM |
1.0 ug DNA |
EUR 1355 |
Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat) |
K7541805 |
ABM |
3 x 1.0 ug |
EUR 376 |
MFN2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K1296505 |
ABM |
3 x 1.0 ug |
EUR 376 |
Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
K3805405 |
ABM |
3 x 1.0 ug |
EUR 376 |
Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1) |
K7541806 |
ABM |
1.0 ug DNA |
EUR 167 |
Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2) |
K7541807 |
ABM |
1.0 ug DNA |
EUR 167 |
Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3) |
K7541808 |
ABM |
1.0 ug DNA |
EUR 167 |
MFN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA) |
LV666284 |
ABM |
1.0 ug DNA |
EUR 1355 |
MFN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
LV666285 |
ABM |
1.0 ug DNA |
EUR 1413 |
MFN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
LV666286 |
ABM |
1.0 ug DNA |
EUR 1413 |
MFN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K1296506 |
ABM |
1.0 ug DNA |
EUR 167 |
MFN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K1296507 |
ABM |
1.0 ug DNA |
EUR 167 |
MFN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K1296508 |
ABM |
1.0 ug DNA |
EUR 167 |
Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1) |
K3805406 |
ABM |
1.0 ug DNA |
EUR 167 |
Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2) |
K3805407 |
ABM |
1.0 ug DNA |
EUR 167 |
Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3) |
K3805408 |
ABM |
1.0 ug DNA |
EUR 167 |
Anti-Anti-SEPT6 antibody antibody |
STJ11100949 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined. |
Anti-Anti-SEPT9 Antibody antibody |
STJ111369 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described. |
Efficiency analysis of the polyclonal anti-rabies virus ribonucleoprotein IgG antibodies produced in-house to be used in direct fluorescent antibody check.
Fluorescein isothiocyanate (FITC) labelled anti-rabies virus ribonucleoprotein (RNP) antibodies can be utilized as immunoreagents in direct fluorescent antibody testing (dFAT) for rabies diagnoses. Whereas in-house merchandise are sometimes utilized by laboratories, most conjugates are business reagents. Business anti-RNP antibodies are solely accessible for analysis functions in Brazil, nevertheless, which contributes to the rising use of in-house produced antibodies.
Contemplating that conjugate high quality might affect the outcomes obtained throughout rabies analysis, we sought to investigate the efficiency necessities of in-house produced polyclonal anti-RNP IgG-FITC for utility in dFAT. To that finish, their reproducibility, diagnostic sensitivity, and specificity have been evaluated. The titer of polyclonal anti-RNP IgG-FITC was initially decided and evaluated by dFAT, utilizing central nervous system (CNS) samples of various animal species (canines, cats, bovines, equines, bats, and non-human primates).
As our predominant end result, the polyclonal anti-RNP IgG-FITC reached a titer of 1:30/1:40 in dFAT, with 100% of diagnostic sensitivity and specificity. When it comes to reproducibility, the antibodies, regardless the manufacturing batch, introduced the identical performances. In conclusion, the in-house produced polyclonal anti-RNP IgG-FITC proved appropriate for rabies virus antigen detection by dFAT.
Manufacturing of F(ab’)2 from Monoclonal and Polyclonal Antibodies.
Antibodies are broadly utilized in therapeutic, diagnostic, and analysis purposes, and antibody derivatives reminiscent of F(ab’)2 fragments are used when solely a specific antibody area is required. F(ab’)2 will be produced via antibody engineering, however some purposes require F(ab’)2 produced from an authentic formulated antibody or instantly from a polyclonal antibody pool.
The cysteine protease immunoglobulin-degrading enzyme (IdeS) from Streptococcus pyogenes digests immunoglobulin G (IgG) particularly and effectively to supply F(ab’)2 . Right here we element the manufacturing and purification of recombinant IdeS; its utilization to digest monoclonal or polyclonal antibodies to F(ab’)2 fragments; and F(ab’)2 purification via consecutive affinity chromatography steps.
The resultant F(ab’)2 exhibit excessive purity, retain antigen-binding performance, and are readily utilizable in numerous downstream purposes. © 2020 by John Wiley & Sons, Inc. Primary Protocol: Manufacturing and purification of F(ab’)2 fragments from monoclonal and polyclonal antibodies utilizing IdeS Alternate Protocol: Purification of polyclonal antigen-specific F(ab’)2 fragments from human serum or secretions Help Protocol: Manufacturing and purification of IdeS.
Analysis of liquid and powdered types of polyclonal antibody preparation towards Streptococcus bovis and Fusobacterium necrophorum in cattle tailored or not tailored to extremely fermentable carbohydrate diets.
Feed components that modify rumen fermentation can be utilized to forestall metabolic disturbances reminiscent of acidosis and optimize beef cattle manufacturing. The research evaluated the consequences of liquid and powdered types of polyclonal antibody preparation (PAP) towards Streptococcus bovis and Fusobacterium necrophorum on rumen fermentation parameters in ruminally cannulated non-lactating dairy cows that have been tailored or unadapted to a excessive focus weight-reduction plan.
A double 3 × Three Latin sq. design was used with three PAP therapies (management, powdered and liquid PAP) and two adaptation protocols (tailored, unadapted; utilized to the sq.). Tailored animals have been transitioned for two weeks from an all-forage to an 80% focus weight-reduction plan, whereas unadapted animals have been switched abruptly.
Interactions between sampling time and adaptation have been noticed; 12 h after feeding, the tailored group had decrease ruminal pH and larger complete brief chain fatty acid concentrations than the unadapted group, whereas the alternative was noticed after 24 h. Acetate:propionate ratio, molar proportion of butyrate and ammonia nitrogen focus have been typically larger in tailored than unadapted cattle as much as 36 h after feeding.
Adaptation promoted 3.5 instances the variety of Entodinium protozoa however copy numbers of S. bovis and Fibrobacter succinogens genes in rumen fluid weren’t affected. Nonetheless, neither liquid nor powdered types of PAP altered rumen acidosis variables in tailored or unadapted animals.Adaptation of cattle to extremely fermentable carbohydrate diets promoted a extra secure ruminal setting, however PAP was not efficient on this research by which no animal skilled acute or sub-acute rumen acidosis.
Anti-DNMT3A antibody |
STJ28586 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase that is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes to the cytoplasm and nucleus and its expression is developmentally regulated. |
Anti-DNMT3A antibody |
STJ23412 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase that is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes to the cytoplasm and nucleus and its expression is developmentally regulated. |
Anti-DNMT3A antibody |
STJ23413 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase that is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes to the cytoplasm and nucleus and its expression is developmentally regulated. |
Anti-DNMT3A antibody |
STJ113373 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase that is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes to the cytoplasm and nucleus and its expression is developmentally regulated. |
anti-Dnmt3a |
YF-PA11403 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Dnmt3a |
anti-Dnmt3a |
YF-PA11404 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to Dnmt3a |
anti-Dnmt3a |
YF-PA11405 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to Dnmt3a |
Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit |
DLR-DNMT3A-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3A (DNMT3A) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit |
DLR-DNMT3A-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3A (DNMT3A) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit |
RDR-DNMT3A-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit |
RDR-DNMT3A-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit |
RD-DNMT3A-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit |
RD-DNMT3A-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Rabbit Polyclonal antibody Anti-CRBN |
Anti-CRBN |
ImmunoStep |
50 µg |
EUR 349 |
Anti-Dnmt3a Rabbit Monoclonal Antibody |
M00136 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Dnmt3a Antibody. Validated in IF, WB and tested in Human, Rat. |
DNMT3A antibody |
38611-100ul |
SAB |
100ul |
EUR 252 |
DNMT3A antibody |
38966-100ul |
SAB |
100ul |
EUR 252 |
Dnmt3a Antibody |
48869-100ul |
SAB |
100ul |
EUR 333 |
Dnmt3a Antibody |
48869-50ul |
SAB |
50ul |
EUR 239 |
DNMT3A Antibody |
32580-100ul |
SAB |
100ul |
EUR 252 |
DNMT3A antibody |
70R-16903 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DNMT3A antibody |
DNMT3A Antibody |
DF6795 |
Affbiotech |
200ul |
EUR 304 |
Description: DNMT3A Antibody detects endogenous levels of total DNMT3A. |
DNMT3A Antibody |
DF7226 |
Affbiotech |
200ul |
EUR 304 |
Description: DNMT3A Antibody detects endogenous levels of total DNMT3A. |
DNMT3A Antibody |
1-CSB-PA007083GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
DNMT3A Antibody |
1-CSB-PA007083LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
DNMT3A Antibody |
1-CSB-PA632606 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
DNMT3A Antibody |
1-CSB-PA522891 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
DNMT3A Antibody |
1-CSB-PA094007 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:100-1:300 |
DNMT3A Antibody |
1-CSB-PA045919 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300 |
Anti-Dnmt3a (mouse) Monoclonal Antibody (64B1446) |
M00136-1 |
BosterBio |
100ug |
EUR 446 |
Description: Mouse Monoclonal Dnmt3a (mouse) Antibody (64B1446). Validated in IP, IF, IHC, WB and tested in Mouse. |
Dnmt3a Conjugated Antibody |
C48869 |
SAB |
100ul |
EUR 397 |
DNMT3A Conjugated Antibody |
C32580 |
SAB |
100ul |
EUR 397 |
DNMT3A Polyclonal Antibody |
A-1003 |
EpiGentek |
100 µl |
EUR 616.95 |
Description: kits suitable for this type of research |
DNMT3A Polyclonal Antibody |
A52569 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
DNMT3A polyclonal antibody |
6849-25 |
Biovision |
|
EUR 370 |
DNMT3A siRNA |
20-abx901552 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DNMT3A Protein |
E11000 |
EpiGentek |
10 µg |
EUR 809.8 |
Description: fast delivery possible |
DNMT3A siRNA |
20-abx914453 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DNMT3A siRNA |
20-abx914454 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC551898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF555 conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC551898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF555 conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC611898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF660R conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC611898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF660R conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC401898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF640R conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC401898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF640R conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC431898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF543 conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC431898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF543 conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC471898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF647 conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC471898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF647 conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC051898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF405M conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC051898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF405M conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC041898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF405S conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC041898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF405S conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNUB1898-100 |
Biotium |
100uL |
EUR 264 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Concentration: 0.2mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNUB1898-50 |
Biotium |
50uL |
EUR 405 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), 1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNUB1898-500 |
Biotium |
500uL |
EUR 513 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Concentration: 0.2mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC681898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF568 conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC681898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF568 conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC701898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF770 conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC701898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF770 conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC881898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF488A conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC881898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF488A conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC941898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF594 conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC941898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF594 conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNCB1898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Biotin conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNCB1898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Biotin conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNCH1898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNCH1898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC801898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF680 conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC801898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF680 conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNCP1898-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), PerCP conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNCR1898-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), RPE conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNCA1898-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), APC conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNCAP1898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNCAP1898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC811898-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF680R conjugate, Concentration: 0.1mg/mL |
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody |
BNC811898-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF680R conjugate, Concentration: 0.1mg/mL |
DNMT3A Antibody, HRP conjugated |
1-CSB-PA007083LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
DNMT3A Antibody, FITC conjugated |
1-CSB-PA007083LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
DNMT3A Antibody, Biotin conjugated |
1-CSB-PA007083LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |