purification of LpxA of Chlamydia trachomatis and preparation of its polyclonal antibody.  


The expression and purification of LpxA of Chlamydia trachomatis and preparation of its polyclonal antibody.


The aim of this research is to purify the LpxA protein of Chlamydia trachomatis (Ct) and put together the polyclonal antibody towards LpxA protein, in order to put a basis for learning the perform of LpxA protein. The LpxA gene was amplified by PCR. The expression plasmid pET28a-LpxA was constructed by utilizing pET28a because the vector.


The fusion protein containing 6 histidine tag was induced by IPTG and purified by Ni2+ chromatography gel. The purified His-LpxA protein was used as an immunogen to immunize New Zealand rabbits subcutaneously via the again to arrange polyclonal antibody. Immunoblotting was used to detect the response between the antibody and His-LpxA.

The willpower of polyclonal antibody titer was detected by ELISA. The relative molecular weight of His-LpxA was 32.eight kDa, and it may very well be expressed in Escherichia coli. The purity of the purified protein was about 95%. After immunizing New Zealand rabbits, the antiserum was in a position to acknowledge the recombinant His-LpxA protein with a titer larger than 1:10240. On this research, LpxA protein was efficiently purified and antiserum was ready, which supplied an experimental foundation for learning the perform of LpxA protein.




Anti-Mfn2 antibody

STJ94105 200 µl
EUR 197
Description: Mfn2 is a protein encoded by the MFN2 gene which is approximately 86,4 kDa. Mfn2 is localised to the mitochondrion outer membrane. It is involved in pink/parkin mediated mitophagy, toll-like receptor signalling pathways and glucose / energy metabolism. It is a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mfn2 is ubiquitously expressed at low levels. Mutations in the MFN2 gene may result in Charcot-Marie-Tooth disease. STJ94105 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of Mfn2 protein.

Anti-MFN2 Antibody

STJ501759 100 µg
EUR 476

Anti-MFN2 antibody

STJ112214 100 µl
EUR 277
Description: This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified.

Anti-MFN2 antibody

STJ114644 100 µl
EUR 277
Description: This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified.

Anti-MFN2 antibody

STJ115566 100 µl
EUR 277
Description: This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified.

Anti-MFN2 Antibody (Biotin)

STJ501760 100 µg
EUR 586

Anti-MFN2 Antibody (FITC)

STJ501761 100 µg
EUR 586

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Anti-Mitofusin 2/MFN2 Antibody

PB9265 100ug/vial
EUR 294

Anti-Mitofusin 2/MFN2 Antibody

PA1051 100ug/vial
EUR 294

MFN2 Antibody

ABD8106 100 ug
EUR 438

MFN2 Antibody

33015-100ul 100ul
EUR 252

MFN2 antibody

70R-18496 50 ul
EUR 435
Description: Rabbit polyclonal MFN2 antibody

MFN2 antibody

70R-13734 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal MFN2 antibody

MFN2 Antibody

DF8106 200ul
EUR 304
Description: MFN2 Antibody detects endogenous levels of total MFN2.

MFN2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

MFN2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MFN2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:3000, IHC:1:20-1:200

Polyclonal MFN2 Antibody

APR08441G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MFN2 . This antibody is tested and proven to work in the following applications:

Mfn2 Polyclonal Antibody

ES2784-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Mfn2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Mfn2 Polyclonal Antibody

ES2784-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Mfn2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Mfn2 Polyclonal Antibody

ABP51785-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Mfn2
  • Applications tips:
Description: A polyclonal antibody for detection of Mfn2 from Human, Mouse, Rat. This Mfn2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mfn2

Mfn2 Polyclonal Antibody

ABP51785-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Mfn2
  • Applications tips:
Description: A polyclonal antibody for detection of Mfn2 from Human, Mouse, Rat. This Mfn2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mfn2

Mfn2 Polyclonal Antibody

ABP51785-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Mfn2
  • Applications tips:
Description: A polyclonal antibody for detection of Mfn2 from Human, Mouse, Rat. This Mfn2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Mfn2

Mfn2 Polyclonal Antibody

41141-100ul 100ul
EUR 252

Mfn2 Polyclonal Antibody

41141-50ul 50ul
EUR 187


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal MFN2 Antibody (Center)

APR08442G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MFN2 (Center). This antibody is tested and proven to work in the following applications:

Mfn2 Polyclonal Conjugated Antibody

C41141 100ul
EUR 397

Mitofusin 2 (MFN2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitofusin-2 (MFN2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Mitofusin-2 (MFN2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitofusin-2 (MFN2) Antibody

abx034129-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mitofusin-2 (MFN2) Antibody

abx034129-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mitofusin 2 (MFN2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mitofusin 2 (MFN2) Antibody

abx445068-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody

abx448536-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Mitofusin-2 (MFN2) Antibody

abx235151-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Mitofusin-2 (MFN2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MFN2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MFN2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MFN2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MFN2. Recognizes MFN2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

MFN2 cloning plasmid

CSB-CL013756HU-10ug 10ug
EUR 747
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2274
  • Sequence: atgtccctgctcttctctcgatgcaactctatcgtcacagtcaagaaaaataagagacacatggctgaggtgaatgcatccccacttaagcactttgtcactgccaagaagaagatcaatggcatttttgagcagctgggggcctacatccaggagagcgccaccttccttgaag
  • Show more
Description: A cloning plasmid for the MFN2 gene.

MFN2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

MFN2 Blocking Peptide

DF8106-BP 1mg
EUR 195

Mitofusion 2/MFN2

RA26001 100 ul
EUR 539


PVT13137 2 ug
EUR 391

Mitofusin-2 (MFN2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mitofusin-2 (MFN2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mitofusin-2 (MFN2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mitofusin 2 (MFN2) Antibody (ALP)

abx442465-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (APC)

abx442746-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (Biotin)

abx443026-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (FITC)

abx443306-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (HRP)

abx443587-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (PerCP)

abx444149-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (RPE)

abx444430-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (Streptavidin)

abx444711-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ALP)

abx446781-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (APC)

abx446782-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (PerCP)

abx446787-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (RPE)

abx446788-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (Streptavidin)

abx446789-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 390)

abx440217-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 488)

abx440498-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 565)

abx440779-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 594)

abx441060-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 633)

abx441341-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 655)

abx441622-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 680)

abx441903-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 700)

abx442184-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 390)

abx446773-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 488)

abx446774-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 565)

abx446775-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 594)

abx446776-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 633)

abx446777-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 655)

abx446778-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 680)

abx446779-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (ATTO 700)

abx446780-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Mouse MFN2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF007293 96 Tests
EUR 689

Human MFN2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MFN2 Recombinant Protein (Human)

RP019252 100 ug Ask for price

MFN2 Recombinant Protein (Rat)

RP211526 100 ug Ask for price

pCMV-SPORT6-MFN2 Plasmid

PVTB00467 2 ug
EUR 356

pCMV-HA-MFN2 Plasmid

PVTB00467-2a 2 ug
EUR 356

MFN2 Recombinant Protein (Mouse)

RP150413 100 ug Ask for price

Monoclonal MFN2 Antibody (monoclonal) (M03), Clone: 4H8

APR08425G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human MFN2 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 4H8. This antibody is applicable in WB and IHC, E

Monoclonal MFN2 Antibody (monoclonal) (M01), Clone: 6A8

APR08443G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human MFN2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 6A8. This antibody is applicable in WB and IHC

Mitofusin 2 (MFN2) Antibody (PE/ATTO 594)

abx443868-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Mitofusin 2 (MFN2) Antibody (PE/ATTO 594)

abx446786-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

MFN2 ORF Vector (Human) (pORF)

ORF006418 1.0 ug DNA
EUR 95

Mfn2 ORF Vector (Mouse) (pORF)

ORF050139 1.0 ug DNA
EUR 506

Mfn2 ORF Vector (Rat) (pORF)

ORF070510 1.0 ug DNA
EUR 506

MFN2 ELISA Kit (Human) (OKCD00471)

OKCD00471 96 Wells
EUR 831
Description: Description of target: Essential transmembrane GTPase, which mediates mitochondrial fusion. Fusion of mitochondria occurs in many cell types and constitutes an important step in mitochondria morphology, which is balanced between fusion and fission. MFN2 acts independently of the cytoskeleton. It therefore plays a central role in mitochondrial metabolism and may be associated with obesity and/or apoptosis processes. Overexpression induces the formation of mitochondrial networks. Plays an important role in the regulation of vascular smooth muscle cell proliferation. Involved in the clearance of damaged mitochondria via selective autophagy (mitophagy). Is required for PARK2 recruitment to dysfunctional mitochondria. Involved in the control of unfolded protein response (UPR) upon ER stress including activation of apoptosis and autophagy during ER stress. Acts as an upstream regulator of EIF2AK3 and suppresses EIF2AK3 activation under basal conditions.5 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.2"Dysregulation of HSG triggers vascular proliferative disorders."_x005F_x005F_x000D_Chen K.-H., Guo X., Ma D., Guo Y., Li Q., Yang D., Li P., Qiu X., Wen S., Xiao R.-P., Tang J._x005F_x005F_x000D_Nat. Cell Biol. 6:872-883(2004) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), FUNCTION, DISEASE.Ref.9"Control of mitochondrial morphology by a human mitofusin."_x005F_x005F_x000D_Santel A., Fuller M.T._x005F_x005F_x000D_J. Cell Sci. 114:867-874(2001) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, MUTAGENESIS OF LYS-109; 622-GLY--VAL-624 AND 657-LYS--ARG-659.Ref.10"Membrane topology and mitochondrial targeting of mitofusins, ubiquitous mammalian homologs of the transmembrane GTPase Fzo."_x005F_x005F_x000D_Rojo M., Legros F., Chateau D., Lombes A._x005F_x005F_x000D_J. Cell Sci. 115:1663-1674(2002) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, MEMBRANE TOPOLOGY, TISSUE SPECIFICITY, MUTAGENESIS OF LYS-109; SER-110 AND ARG-259.Ref.16"MiD49 and MiD51 can act independently of Mff and Fis1 in Drp1 recruitment and are specific for mitochondrial fission."_x005F_x005F_x000D_Palmer C.S., Elgass K.D., Parton R.G., Osellame L.D., Stojanovski D., Ryan M.T._x005F_x005F_x000D_J. Biol. Chem. 288:27584-27593(2013) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.17"PINK1-phosphorylated mitofusin 2 is a Parkin receptor for culling damaged mitochondria."_x005F_x005F_x000D_Chen Y., Dorn G.W. II_x005F_x005F_x000D_Science 340:471-475(2013) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN MITOPHAGY, INTERACTION WITH PARK2, PHOSPHORYLATION AT THR-111 AND SER-442 BY PINK1, UBIQUITINATION BY PARK2, SUBCELLULAR LOCATION, MUTAGENESIS OF THR-111 AND SER-442. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

MFN2 ELISA Kit (Human) (OKEH08248)

OKEH08248 96 Wells
EUR 896
Description: Description of target: This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 35pg/mL

Human MFN2(Mitofusin-2) ELISA Kit

EH4039 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Alias: Mitofusin-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Rat Mitofusin- 2, Mfn2 ELISA KIT

ELI-23089r 96 Tests
EUR 886

Human Mitofusin- 2, MFN2 ELISA KIT

ELI-16285h 96 Tests
EUR 824

Mouse Mitofusin- 2, Mfn2 ELISA KIT

ELI-31284m 96 Tests
EUR 865

Human Mitofusin 2 (MFN2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Mitofusin 2 (MFN2) ELISA Kit

abx259144-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Mitofusin 2 (MFN2) ELISA Kit

abx259146-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Mitofusin 2 (MFN2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Mitofusin-2 (MFN2) ELISA Kit

abx257748-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

MFN2 sgRNA CRISPR Lentivector set (Human)

K1296501 3 x 1.0 ug
EUR 339

Mfn2 sgRNA CRISPR Lentivector set (Rat)

K7541801 3 x 1.0 ug
EUR 339

Mfn2 sgRNA CRISPR Lentivector set (Mouse)

K3805401 3 x 1.0 ug
EUR 339

Human Mitofusin 2 ELISA Kit (MFN2)

RK01841 96 Tests
EUR 521

Human Mitofusin 2 (MFN2) ELISA Kit

SEF591Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mitofusin 2 (MFN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mitofusin 2 (MFN2) in tissue homogenates, cell lysates and other biological fluids.

Human Mitofusin 2 (MFN2) ELISA Kit

SEF591Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mitofusin 2 (MFN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mitofusin 2 (MFN2) in tissue homogenates, cell lysates and other biological fluids.

Human Mitofusin 2 (MFN2) ELISA Kit

SEF591Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mitofusin 2 (MFN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mitofusin 2 (MFN2) in tissue homogenates, cell lysates and other biological fluids.

Human Mitofusin 2 (MFN2) ELISA Kit

SEF591Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mitofusin 2 (MFN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mitofusin 2 (MFN2) in tissue homogenates, cell lysates and other biological fluids.

Human Mitofusin 2 (MFN2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Mitofusin 2 elisa. Alternative names of the recognized antigen: CMT2A
  • CMT2A2
  • CPRP1
  • HSG
  • MARF
  • Transmembrane GTPase MFN2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Mitofusin 2 (MFN2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human MFN2 (Mitofusin 2)

ELK5212 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Mitofusin 2 (MFN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mitofusin 2 (MF
  • Show more
Description: A sandwich ELISA kit for detection of Mitofusin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

MFN2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1296502 1.0 ug DNA
EUR 154

MFN2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1296503 1.0 ug DNA
EUR 154

MFN2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1296504 1.0 ug DNA
EUR 154

Mfn2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7541802 1.0 ug DNA
EUR 154

Mfn2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7541803 1.0 ug DNA
EUR 154

Mfn2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7541804 1.0 ug DNA
EUR 154

Mfn2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3805402 1.0 ug DNA
EUR 154

Mfn2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3805403 1.0 ug DNA
EUR 154

Mfn2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3805404 1.0 ug DNA
EUR 154

ELISA kit for Rat Mitofusin-2 (MFN2)

KTE100625-48T 48T
EUR 332
  • MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Mitofusin-2 (MFN2)

KTE100625-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Mitofusin-2 (MFN2)

KTE100625-96T 96T
EUR 539
  • MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mitofusin-2 (MFN2)

KTE61636-48T 48T
EUR 332
  • MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mitofusin-2 (MFN2)

KTE61636-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mitofusin-2 (MFN2)

KTE61636-96T 96T
EUR 539
  • MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. Mitofusin-2 is involved in the regulation of vascular smooth muscle cell proliferat
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mitofusin-2 (MFN2)

KTE71041-48T 48T
EUR 332
  • MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell prolifera
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mitofusin-2 (MFN2)

KTE71041-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell prolifera
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mitofusin-2 (MFN2)

KTE71041-96T 96T
EUR 539
  • MFN2 encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell prolifera
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mitofusin-2 (MFN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

MFN2 Protein Vector (Rat) (pPB-C-His)

PV282038 500 ng
EUR 1166

MFN2 Protein Vector (Rat) (pPB-N-His)

PV282039 500 ng
EUR 1166

MFN2 Protein Vector (Rat) (pPM-C-HA)

PV282040 500 ng
EUR 1166

MFN2 Protein Vector (Rat) (pPM-C-His)

PV282041 500 ng
EUR 1166

MFN2 Protein Vector (Human) (pPB-C-His)

PV025669 500 ng
EUR 329

MFN2 Protein Vector (Human) (pPB-N-His)

PV025670 500 ng
EUR 329

MFN2 Protein Vector (Human) (pPM-C-HA)

PV025671 500 ng
EUR 329

MFN2 Protein Vector (Human) (pPM-C-His)

PV025672 500 ng
EUR 329

MFN2 Protein Vector (Mouse) (pPB-C-His)

PV200554 500 ng
EUR 1065

MFN2 Protein Vector (Mouse) (pPB-N-His)

PV200555 500 ng
EUR 1065

MFN2 Protein Vector (Mouse) (pPM-C-HA)

PV200556 500 ng
EUR 1065

MFN2 Protein Vector (Mouse) (pPM-C-His)

PV200557 500 ng
EUR 1065

Mfn2 3'UTR GFP Stable Cell Line

TU163146 1.0 ml Ask for price

Mfn2 3'UTR Luciferase Stable Cell Line

TU213112 1.0 ml Ask for price

MFN2 3'UTR Luciferase Stable Cell Line

TU013296 1.0 ml
EUR 1521

Mfn2 3'UTR Luciferase Stable Cell Line

TU113146 1.0 ml Ask for price

MFN2 3'UTR GFP Stable Cell Line

TU063296 1.0 ml
EUR 1521

Mfn2 3'UTR GFP Stable Cell Line

TU263112 1.0 ml Ask for price

Mfn2 ELISA Kit| Rat Mitofusin-2 ELISA Kit

EF018980 96 Tests
EUR 689

Mfn2 ELISA Kit| Mouse Mitofusin-2 ELISA Kit

EF015539 96 Tests
EUR 689

MFN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV666283 1.0 ug DNA
EUR 1355

MFN2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV666287 1.0 ug DNA
EUR 1355

MFN2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV666288 1.0 ug DNA
EUR 1355

MFN2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1296505 3 x 1.0 ug
EUR 376

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7541805 3 x 1.0 ug
EUR 376

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3805405 3 x 1.0 ug
EUR 376

MFN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1296506 1.0 ug DNA
EUR 167

MFN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1296507 1.0 ug DNA
EUR 167

MFN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1296508 1.0 ug DNA
EUR 167

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7541806 1.0 ug DNA
EUR 167

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7541807 1.0 ug DNA
EUR 167

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7541808 1.0 ug DNA
EUR 167

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3805406 1.0 ug DNA
EUR 167

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3805407 1.0 ug DNA
EUR 167

Mfn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3805408 1.0 ug DNA
EUR 167

MFN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV666284 1.0 ug DNA
EUR 1355

MFN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV666285 1.0 ug DNA
EUR 1413

MFN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV666286 1.0 ug DNA
EUR 1413

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.


Efficiency analysis of the polyclonal anti-rabies virus ribonucleoprotein IgG antibodies produced in-house to be used in direct fluorescent antibody check.


Fluorescein isothiocyanate (FITC) labelled anti-rabies virus ribonucleoprotein (RNP) antibodies can be utilized as immunoreagents in direct fluorescent antibody testing (dFAT) for rabies diagnoses. Whereas in-house merchandise are sometimes utilized by laboratories, most conjugates are business reagents. Business anti-RNP antibodies are solely accessible for analysis functions in Brazil, nevertheless, which contributes to the rising use of in-house produced antibodies.


Contemplating that conjugate high quality might affect the outcomes obtained throughout rabies analysis, we sought to investigate the efficiency necessities of in-house produced polyclonal anti-RNP IgG-FITC for utility in dFAT. To that finish, their reproducibility, diagnostic sensitivity, and specificity have been evaluated. The titer of polyclonal anti-RNP IgG-FITC was initially decided and evaluated by dFAT, utilizing central nervous system (CNS) samples of various animal species (canines, cats, bovines, equines, bats, and non-human primates).


As our predominant end result, the polyclonal anti-RNP IgG-FITC reached a titer of 1:30/1:40 in dFAT, with 100% of diagnostic sensitivity and specificity. When it comes to reproducibility, the antibodies, regardless the manufacturing batch, introduced the identical performances. In conclusion, the in-house produced polyclonal anti-RNP IgG-FITC proved appropriate for rabies virus antigen detection by dFAT.


Manufacturing of F(ab’)2 from Monoclonal and Polyclonal Antibodies.


Antibodies are broadly utilized in therapeutic, diagnostic, and analysis purposes, and antibody derivatives reminiscent of F(ab’)2 fragments are used when solely a specific antibody area is required. F(ab’)2 will be produced via antibody engineering, however some purposes require F(ab’)2 produced from an authentic formulated antibody or instantly from a polyclonal antibody pool.

The cysteine protease immunoglobulin-degrading enzyme (IdeS) from Streptococcus pyogenes digests immunoglobulin G (IgG) particularly and effectively to supply F(ab’)2 . Right here we element the manufacturing and purification of recombinant IdeS; its utilization to digest monoclonal or polyclonal antibodies to F(ab’)2 fragments; and F(ab’)2 purification via consecutive affinity chromatography steps.

The resultant F(ab’)2 exhibit excessive purity, retain antigen-binding performance, and are readily utilizable in numerous downstream purposes. © 2020 by John Wiley & Sons, Inc. Primary Protocol: Manufacturing and purification of F(ab’)2 fragments from monoclonal and polyclonal antibodies utilizing IdeS Alternate Protocol: Purification of polyclonal antigen-specific F(ab’)2 fragments from human serum or secretions Help Protocol: Manufacturing and purification of IdeS.


Analysis of liquid and powdered types of polyclonal antibody preparation towards Streptococcus bovis and Fusobacterium necrophorum in cattle tailored or not tailored to extremely fermentable carbohydrate diets.


Feed components that modify rumen fermentation can be utilized to forestall metabolic disturbances reminiscent of acidosis and optimize beef cattle manufacturing. The research evaluated the consequences of liquid and powdered types of polyclonal antibody preparation (PAP) towards Streptococcus bovis and Fusobacterium necrophorum on rumen fermentation parameters in ruminally cannulated non-lactating dairy cows that have been tailored or unadapted to a excessive focus weight-reduction plan.

A double 3 × Three Latin sq. design was used with three PAP therapies (management, powdered and liquid PAP) and two adaptation protocols (tailored, unadapted; utilized to the sq.). Tailored animals have been transitioned for two weeks from an all-forage to an 80% focus weight-reduction plan, whereas unadapted animals have been switched abruptly.


Interactions between sampling time and adaptation have been noticed; 12 h after feeding, the tailored group had decrease ruminal pH and larger complete brief chain fatty acid concentrations than the unadapted group, whereas the alternative was noticed after 24 h. Acetate:propionate ratio, molar proportion of butyrate and ammonia nitrogen focus have been typically larger in tailored than unadapted cattle as much as 36 h after feeding.


Adaptation promoted 3.5 instances the variety of Entodinium protozoa however copy numbers of S. bovis and Fibrobacter succinogens genes in rumen fluid weren’t affected. Nonetheless, neither liquid nor powdered types of PAP altered rumen acidosis variables in tailored or unadapted animals.Adaptation of cattle to extremely fermentable carbohydrate diets promoted a extra secure ruminal setting, however PAP was not efficient on this research by which no animal skilled acute or sub-acute rumen acidosis.

Anti-DNMT3A antibody
PAab02484 100 ug
EUR 355
Anti-DNMT3A antibody
PAab02485 100 ug
EUR 355
Anti-DNMT3A antibody
STJ28586 100 µl
EUR 277
Description: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase that is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes to the cytoplasm and nucleus and its expression is developmentally regulated.
Anti-DNMT3A antibody
STJ23412 100 µl
EUR 277
Description: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase that is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes to the cytoplasm and nucleus and its expression is developmentally regulated.
Anti-DNMT3A antibody
STJ23413 100 µl
EUR 277
Description: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase that is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes to the cytoplasm and nucleus and its expression is developmentally regulated.
Anti-DNMT3A antibody
STJ113373 100 µl
EUR 277
Description: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase that is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes to the cytoplasm and nucleus and its expression is developmentally regulated.
Anti-DNMT3A antibody
STJ119211 100 µl
EUR 277
YF-PA11403 50 ug
EUR 363
Description: Mouse polyclonal to Dnmt3a
YF-PA11404 100 ul
EUR 403
Description: Rabbit polyclonal to Dnmt3a
YF-PA11405 100 ug
EUR 403
Description: Rabbit polyclonal to Dnmt3a
Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
EUR 517
  • Should the Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3A (DNMT3A) in samples from tissue homogenates, cell lysates or other biological fluids.
Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
EUR 673
  • Should the Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DNA Methyltransferase 3A (DNMT3A) in samples from tissue homogenates, cell lysates or other biological fluids.
Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
RDR-DNMT3A-Hu-48Tests 48 Tests
EUR 544
Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
RDR-DNMT3A-Hu-96Tests 96 Tests
EUR 756
Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
RD-DNMT3A-Hu-48Tests 48 Tests
EUR 521
Human DNA Methyltransferase 3A (DNMT3A) ELISA Kit
RD-DNMT3A-Hu-96Tests 96 Tests
EUR 723
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
Anti-Dnmt3a Rabbit Monoclonal Antibody
M00136 100ug/vial
EUR 397
Description: Rabbit Monoclonal Dnmt3a Antibody. Validated in IF, WB and tested in Human, Rat.
Anti-DiMethyl-DNMT3A-K44 antibody
STJ118467 100 µl
EUR 393
DNMT3A Antibody
ABD6795 100 ug
EUR 438
DNMT3A Antibody
ABD7226 100 ug
EUR 438
DNMT3A antibody
38611-100ul 100ul
EUR 252
DNMT3A antibody
38966-100ul 100ul
EUR 252
Dnmt3a Antibody
48869-100ul 100ul
EUR 333
Dnmt3a Antibody
48869-50ul 50ul
EUR 239
DNMT3a Antibody
EUR 349
DNMT3a Antibody
EUR 146
DNMT3A Antibody
32580-100ul 100ul
EUR 252
DNMT3A antibody
70R-16903 50 ul
EUR 435
Description: Rabbit polyclonal DNMT3A antibody
DNMT3A Antibody
DF6795 200ul
EUR 304
Description: DNMT3A Antibody detects endogenous levels of total DNMT3A.
DNMT3A Antibody
DF7226 200ul
EUR 304
Description: DNMT3A Antibody detects endogenous levels of total DNMT3A.
DNMT3A Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
DNMT3A Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
DNMT3A Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
DNMT3A Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
DNMT3A Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:100-1:300
DNMT3A Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300
Anti-Dnmt3a (mouse) Monoclonal Antibody (64B1446)
M00136-1 100ug
EUR 446
Description: Mouse Monoclonal Dnmt3a (mouse) Antibody (64B1446). Validated in IP, IF, IHC, WB and tested in Mouse.
Dnmt3a Conjugated Antibody
C48869 100ul
EUR 397
DNMT3A Conjugated Antibody
C32580 100ul
EUR 397
DNMT3A Polyclonal Antibody
A-1003 100 µl
EUR 616.95
Description: kits suitable for this type of research
DNMT3A Polyclonal Antibody
A52569 100 µg
EUR 570.55
Description: kits suitable for this type of research
DNMT3A polyclonal antibody
EUR 370
Dnmt3a/ Rat Dnmt3a ELISA Kit
ELI-09442r 96 Tests
EUR 886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DNMT3A Protein
E11000 10 µg
EUR 809.8
Description: fast delivery possible
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PVT10312 2 ug
EUR 266
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC551898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF555 conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC551898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF555 conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC611898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF660R conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC611898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF660R conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC401898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF640R conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC401898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF640R conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC431898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF543 conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC431898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF543 conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC471898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF647 conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC471898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF647 conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC051898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF405M conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC051898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF405M conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC041898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF405S conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC041898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF405S conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNUB1898-100 100uL
EUR 264
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Concentration: 0.2mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNUB1898-50 50uL
EUR 405
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), 1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNUB1898-500 500uL
EUR 513
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Concentration: 0.2mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC681898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF568 conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC681898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF568 conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC701898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF770 conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC701898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF770 conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC881898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF488A conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC881898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF488A conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC941898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF594 conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC941898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF594 conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCB1898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Biotin conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCB1898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Biotin conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCH1898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCH1898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC801898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF680 conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC801898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF680 conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCP1898-250 250uL
EUR 394
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), PerCP conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCR1898-250 250uL
EUR 394
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), RPE conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCA1898-250 250uL
EUR 394
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), APC conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCAP1898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNCAP1898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC811898-100 100uL
EUR 233
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF680R conjugate, Concentration: 0.1mg/mL
DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2) Antibody
BNC811898-500 500uL
EUR 545
Description: Primary antibody against DNMT3A / DNA Methyltransferase 3 Alpha (PCRP-DNMT3A-1E2), CF680R conjugate, Concentration: 0.1mg/mL
DNMT3A Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
DNMT3A Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
DNMT3A Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNMT3A. Recognizes DNMT3A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Leave a Reply

Your email address will not be published. Required fields are marked *