Soluble Epoxide Hydrolase Detection by Combining a Polyclonal Capture Antibody


Improvement of a Extremely Delicate Enzyme-Linked Immunosorbent Assay for Mouse Soluble Epoxide Hydrolase Detection by Combining a Polyclonal Seize Antibody with a Nanobody Tracer

  Enzyme-linked immunosorbent assays (ELISA) for the detection of soluble epoxide hydrolase (sEH), a key enzyme within the metabolism of fatty acids and a biomarker, could more and more signify an necessary diagnostic software. Nonetheless, there’s a lack of ELISAs for mouse sEH quantification, thus leading to a bottleneck in understanding the pathogenesis of many ailments associated to sEH based mostly on mouse fashions. On this work, nanobodies recognizing mouse sEH had been obtained by way of rebiopanning in opposition to mouse sEH within the earlier phage show library of human sEH. Later, we developed 4 ELISAs involving a mix of anti-mouse sEH polyclonal antibodies (pAbs) and nanobodies.   It was discovered that the double antibodies labored as twin filters and had a huge effect on each the sensitivity and selectivity of sandwich immunoassays. The change from anti-human sEH pAbs to anti-mouse sEH pAbs led to over a 100-fold enhance within the sensitivity and a dramatic lower of the restrict of detection to a picogram per milliliter vary in format B (pAb/biotin-VHH/streptavidin-poly-horseradish peroxidase). Furthermore, we discovered that the 4 sandwich ELISAs may exhibit wonderful selectivities to mouse sEH, regardless of the antibodies alone exhibiting important cross-reactivity to the matrix, indicating the improved selectivity of double antibodies as twin filters.   Finally, for the primary time, the ELISA (format B) was efficiently used to measure the mouse sEH level in most cancers cells with ultralow abundances. The ELISAs proposed right here signify a delicate software for monitoring sEH in varied organic processes and likewise present deep insights into growing sandwich immunoassays in opposition to varied targets when it comes to each the sensitivity and selectivity.



DNAJB14 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

DNAJB14 Antibody

DF12198 200ul
EUR 304.00
Description: DNAJB14 antibody detects endogenous levels of DNAJB14.

DNAJB14 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DNAJB14 Polyclonal Antibody

30628-100ul 100ul
EUR 252.00

DNAJB14 Polyclonal Antibody

30628-50ul 50ul
EUR 187.00

DNAJB14 Polyclonal Antibody

A66234 100 µg
EUR 570.55
Description: reagents widely cited


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

DNAJB14 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DNAJB14 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DNAJB14 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNAJB14. Recognizes DNAJB14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DNAJB14 Polyclonal Conjugated Antibody

C30628 100ul
EUR 397.00

DNAJB14 Blocking Peptide

DF12198-BP 1mg
EUR 195.00

DNAJB14 cloning plasmid

CSB-CL819454HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1140
  • Sequence: atggaggggaacagggatgaggctgagaaatgtgtcgagatcgcccgggaggccctgaacgccggcaaccgcgagaaggcccagcgcttcctgcagaaggccgagaagctctacccactgccctcggcccgcgcactattggaaataattatgaaaaatggaagcacggctggaa
  • Show more
Description: A cloning plasmid for the DNAJB14 gene.

DNAJB14 Rabbit pAb

A4990-100ul 100 ul
EUR 308.00

DNAJB14 Rabbit pAb

A4990-200ul 200 ul
EUR 459.00

DNAJB14 Rabbit pAb

A4990-20ul 20 ul
EUR 183.00

DNAJB14 Rabbit pAb

A4990-50ul 50 ul
EUR 223.00

DNAJB14 Polyclonal Antibody, HRP Conjugated

A66235 100 µg
EUR 570.55
Description: Ask the seller for details

DNAJB14 Polyclonal Antibody, FITC Conjugated

A66236 100 µg
EUR 570.55
Description: The best epigenetics products

DNAJB14 Polyclonal Antibody, Biotin Conjugated

A66237 100 µg
EUR 570.55
Description: kits suitable for this type of research

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280.00

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280.00

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280.00


EF009156 96 Tests
EUR 689.00

Mouse DNAJB14 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human DNAJB14 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

DNAJB14 Recombinant Protein (Human)

RP009529 100 ug Ask for price

DNAJB14 Recombinant Protein (Rat)

RP198299 100 ug Ask for price

DNAJB14 Recombinant Protein (Mouse)

RP129476 100 ug Ask for price

Dnajb14 ORF Vector (Rat) (pORF)

ORF066101 1.0 ug DNA
EUR 506.00

DNAJB14 ORF Vector (Human) (pORF)

ORF003177 1.0 ug DNA
EUR 95.00

Dnajb14 ORF Vector (Mouse) (pORF)

ORF043160 1.0 ug DNA
EUR 506.00

DNAJB14 sgRNA CRISPR Lentivector set (Human)

K0614501 3 x 1.0 ug
EUR 339.00

Dnajb14 sgRNA CRISPR Lentivector set (Rat)

K6216401 3 x 1.0 ug
EUR 339.00

Dnajb14 sgRNA CRISPR Lentivector set (Mouse)

K4586901 3 x 1.0 ug
EUR 339.00

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody

abx232446-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 1)

K0614502 1.0 ug DNA
EUR 154.00

DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 2)

K0614503 1.0 ug DNA
EUR 154.00

DNAJB14 sgRNA CRISPR Lentivector (Human) (Target 3)

K0614504 1.0 ug DNA
EUR 154.00

Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6216402 1.0 ug DNA
EUR 154.00

Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6216403 1.0 ug DNA
EUR 154.00

Dnajb14 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6216404 1.0 ug DNA
EUR 154.00

Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4586902 1.0 ug DNA
EUR 154.00

Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4586903 1.0 ug DNA
EUR 154.00

Dnajb14 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4586904 1.0 ug DNA
EUR 154.00

DNAJB14 Protein Vector (Mouse) (pPB-C-His)

PV172638 500 ng
EUR 603.00

DNAJB14 Protein Vector (Mouse) (pPB-N-His)

PV172639 500 ng
EUR 603.00

DNAJB14 Protein Vector (Mouse) (pPM-C-HA)

PV172640 500 ng
EUR 603.00

DNAJB14 Protein Vector (Mouse) (pPM-C-His)

PV172641 500 ng
EUR 603.00

DNAJB14 Protein Vector (Rat) (pPB-C-His)

PV264402 500 ng
EUR 603.00

DNAJB14 Protein Vector (Rat) (pPB-N-His)

PV264403 500 ng
EUR 603.00

DNAJB14 Protein Vector (Rat) (pPM-C-HA)

PV264404 500 ng
EUR 603.00

DNAJB14 Protein Vector (Rat) (pPM-C-His)

PV264405 500 ng
EUR 603.00

DNAJB14 Protein Vector (Human) (pPB-C-His)

PV012705 500 ng
EUR 329.00

DNAJB14 Protein Vector (Human) (pPB-N-His)

PV012706 500 ng
EUR 329.00

DNAJB14 Protein Vector (Human) (pPM-C-HA)

PV012707 500 ng
EUR 329.00

DNAJB14 Protein Vector (Human) (pPM-C-His)

PV012708 500 ng
EUR 329.00

Dnajb14 3'UTR GFP Stable Cell Line

TU155250 1.0 ml Ask for price

Dnajb14 3'UTR Luciferase Stable Cell Line

TU105250 1.0 ml Ask for price

Dnajb14 3'UTR Luciferase Stable Cell Line

TU203509 1.0 ml Ask for price

Dnajb14 3'UTR GFP Stable Cell Line

TU253509 1.0 ml Ask for price

DNAJB14 3'UTR GFP Stable Cell Line

TU056138 1.0 ml
EUR 2333.00

DNAJB14 3'UTR Luciferase Stable Cell Line

TU006138 1.0 ml
EUR 2333.00

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

DnaJ (Hsp40) Homolog, Subfamily B, Member 14 (DNAJB14) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Human DnaJ homolog subfamily B member 14, DNAJB14 ELISA KIT

ELI-26399h 96 Tests
EUR 824.00

Mouse DnaJ homolog subfamily B member 14, Dnajb14 ELISA KIT

ELI-08275m 96 Tests
EUR 865.00

Human DnaJ Homolog Subfamily B Member 14 (DNAJB14) ELISA Kit

abx386930-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Bovine DnaJ homolog subfamily B member 14, DNAJB14 ELISA KIT

ELI-31942b 96 Tests
EUR 928.00

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0614505 3 x 1.0 ug
EUR 376.00

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6216405 3 x 1.0 ug
EUR 376.00

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4586905 3 x 1.0 ug
EUR 376.00

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0614506 1.0 ug DNA
EUR 167.00

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0614507 1.0 ug DNA
EUR 167.00

DNAJB14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0614508 1.0 ug DNA
EUR 167.00

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6216406 1.0 ug DNA
EUR 167.00

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6216407 1.0 ug DNA
EUR 167.00

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6216408 1.0 ug DNA
EUR 167.00

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4586906 1.0 ug DNA
EUR 167.00

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4586907 1.0 ug DNA
EUR 167.00

Dnajb14 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4586908 1.0 ug DNA
EUR 167.00

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277.00
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277.00
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Prediction of Clearance of Monoclonal and Polyclonal Antibodies and Non-Antibody Proteins in Kids: Software of Allometric Scaling

  Allometric scaling can be utilized for the extrapolation of pharmacokinetic parameters from adults to youngsters. The target of this examine was to foretell clearance of therapeutic proteins (monoclonal and polyclonal antibodies and non-antibody proteins) allometrically in preterm neonates to adolescents. There have been 13 monoclonal antibodies, seven polyclonal antibodies, and 9 therapeutic proteins (non-antibodies) within the examine. The clearance of therapeutic proteins was predicted utilizing the age dependent exponents (ADE) mannequin after which in contrast with the noticed clearance values. There have been in complete 29 therapeutic proteins on this examine with 75 observations. The variety of observations with ≤30%, ≤50%, and >50% prediction error was 60 (80%), 72 (96%), and three (4%), respectively. General, the anticipated clearance values of therapeutic proteins in youngsters was good. The allometric technique proposed on this manuscript can be utilized to pick out first-in-pediatric dose of therapeutic proteins in pediatric scientific trials.  

Prokaryotic expression of PE8 protein from Mycobacterium tuberculosis (H37Rv) and preparation of its polyclonal antibody in rabbits

  Goal To clone proline-glutamate 8 (PE8) gene phase from Mycobacterium tuberculosis (H37Rv), assemble the recombinant plasmid pET28a-PE8, categorical recombinant PE8 protein, and put together its polyclonal antibody. Strategies Utilizing a typical homologous recombination cloning expertise, we cloned the PE8 gene into the prokaryotic vector pET28a. After sequence affirmation, it was remodeled into E. coli BL21 (DE3) and handled with 0.5 mmol/L isopropyl-beta-D-thiogalactopyranoside (IPTG) to induce protein expression. We purified and renatured the recombinant PE8 protein, and immunized New Zealand rabbits to arrange the polyclonal antibody. Antibody titer was decided by oblique ELISA and the specificity was evaluated by Western blot evaluation. Outcomes The recombinant plasmid pET28a-PE8 was efficiently constructed, and the PE8 protein was primarily expressed in an inclusion physique in E. coli. After renaturation and purification, a purity of about 90% of the recombinant protein was achieved.   The titer of the polyclonal antibody was greater than 1:430 080. The polyclonal antibody might particularly acknowledge the recombinant PE8 protein. Conclusion We’ve got efficiently expressed and purified recombinant PE8 protein, which might be additional utilized to generate PE8 polyclonal antibody with acceptable titer and specificity   A preliminary analysis of a regionally produced biotinylated polyclonal anti-rabies antibody for direct fast immunohistochemical check (DRIT) within the Philippines   Rabies is a deadly zoonotic illness endemic in growing international locations of Asia and Africa. Not too long ago, the direct fast immunohistochemical check (DRIT) was really useful by the World Well being Group (WHO) and the World Group for Animal Well being (OIE) as a diagnostic check for rabies. Subsequently, a biotinylated polyclonal antibody (pAb) in opposition to the rabies lyssavirus (RABV) nucleoprotein was developed utilizing a plasmid cDNA vaccine derived from a problem virus commonplace 11 pressure. A preliminary analysis on the efficacy of this reagent in recognizing the Philippine RABV pressure was examined utilizing banked canine hippocampal tissue samples with DRIT and the outcomes had been in comparison with dFAT. The results of acetone and formalin fixation on DRIT had been additionally assessed by way of immunoreactivity scores of the specimens. Of the 142 samples examined, 104 examined constructive and 38 adverse utilizing each dFAT and DRIT, exhibiting 100% settlement between the 2 diagnostic procedures. Furthermore, no false constructive or false adverse outcomes had been noticed utilizing acetone and formalin fixation.   Thus, regionally ready biotinylated pAb from plasmid cDNA can be used for DRIT, particularly in resource-limited laboratories within the Philippines. Nonetheless, these outcomes must be confirmed with a extra thorough analysis of this method, and the vary of detection must be additional evaluated in a bigger panel of animal samples and on different lyssaviruses.

Anti-ELMOD2 antibody
STJ116735 100 µl
EUR 277.00
Description: This gene encodes one of six engulfment and motility (ELMO) domain-containing proteins. This gene is thought to play a role in antiviral responses. Mutations in this gene may be involved in the cause of familial idiopathic pulmonary fibrosis.
Anti-ELMOD2 antibody
STJ117198 100 µl
EUR 277.00
Description: This gene encodes one of six engulfment and motility (ELMO) domain-containing proteins. This gene is thought to play a role in antiviral responses. Mutations in this gene may be involved in the cause of familial idiopathic pulmonary fibrosis.
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349.00
ELMOD2 antibody
70R-17080 50 ul
EUR 435.00
Description: Rabbit polyclonal ELMOD2 antibody
ELMOD2 Antibody
39779-100ul 100ul
EUR 390.00
ELMOD2 Antibody
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ELMOD2. Recognizes ELMOD2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200
ELMOD2 antibody
70R-36548 100 ug
EUR 349.00
Description: Rabbit polyclonal ELMOD2 antibody
ELMOD2 antibody
70R-6024 50 ug
EUR 467.00
Description: Rabbit polyclonal ELMOD2 antibody raised against the N terminal of ELMOD2
ELMOD2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ELMOD2. Recognizes ELMOD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
ELMOD2 Polyclonal Antibody
28610-100ul 100ul
EUR 252.00
ELMOD2 Polyclonal Antibody
28610-50ul 50ul
EUR 187.00
ELMOD2 Polyclonal Antibody
28799-100ul 100ul
EUR 252.00
ELMOD2 Polyclonal Antibody
28799-50ul 50ul
EUR 187.00
ELMOD2 Polyclonal Antibody
31367-100ul 100ul
EUR 252.00
ELMOD2 Polyclonal Antibody
31367-50ul 50ul
EUR 187.00
ELMOD2 Polyclonal Antibody
28457-100ul 100ul
EUR 252.00
ELMOD2 Polyclonal Antibody
28457-50ul 50ul
EUR 187.00
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
ELMOD2 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ELMOD2. Recognizes ELMOD2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ELMOD2 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ELMOD2. Recognizes ELMOD2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ELMOD2 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ELMOD2. Recognizes ELMOD2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
ELMOD2 Polyclonal Conjugated Antibody
C28457 100ul
EUR 397.00
ELMOD2 Polyclonal Conjugated Antibody
C28610 100ul
EUR 397.00
ELMOD2 Polyclonal Conjugated Antibody
C28799 100ul
EUR 397.00
ELMOD2 Polyclonal Conjugated Antibody
C31367 100ul
EUR 397.00
ELMOD2 Rabbit pAb
A14205-100ul 100 ul
EUR 308.00
ELMOD2 Rabbit pAb
A14205-200ul 200 ul
EUR 459.00
ELMOD2 Rabbit pAb
A14205-20ul 20 ul
EUR 183.00
ELMOD2 Rabbit pAb
A14205-50ul 50 ul
EUR 223.00
ELMOD2 Rabbit pAb
A14524-100ul 100 ul
EUR 308.00
ELMOD2 Rabbit pAb
A14524-200ul 200 ul
EUR 459.00
ELMOD2 Rabbit pAb
A14524-20ul 20 ul
EUR 183.00
ELMOD2 Rabbit pAb
A14524-50ul 50 ul
EUR 223.00
ELMOD2 Blocking Peptide
33R-2873 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ELMOD2 antibody, catalog no. 70R-6024
ELMOD2 cloning plasmid
CSB-CL815588HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 882
  • Sequence: atgtttatttctttgtgggagttcttctatgggcacttttttcgattttggatgaaatggctattacgacagatgactgggaagtgtgaattgcagcgaatatttgatacctatgtaggtgcacaaaggacacacaggatagaaaattccttgacatactccaagaataaggtttt
  • Show more
Description: A cloning plasmid for the ELMOD2 gene.
ELMOD2 Rabbit pAb
A7859-100ul 100 ul
EUR 308.00
ELMOD2 Rabbit pAb
A7859-200ul 200 ul
EUR 459.00
ELMOD2 Rabbit pAb
A7859-20ul 20 ul
EUR 183.00
ELMOD2 Rabbit pAb
A7859-50ul 50 ul
EUR 223.00
ELMOD2 Rabbit pAb
A15001-100ul 100 ul
EUR 308.00
ELMOD2 Rabbit pAb
A15001-200ul 200 ul
EUR 459.00
ELMOD2 Rabbit pAb
A15001-20ul 20 ul
EUR 183.00
ELMOD2 Rabbit pAb
A15001-50ul 50 ul
EUR 223.00
PVT13990 2 ug
EUR 391.00
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280.00
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280.00
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280.00
EF009374 96 Tests
EUR 689.00
Human ELMOD2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse ELMOD2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
ELMOD2 Recombinant Protein (Human)
RP010591 100 ug Ask for price
ELMOD2 Recombinant Protein (Rat)
RP199505 100 ug Ask for price
ELMOD2 Recombinant Protein (Mouse)
RP131537 100 ug Ask for price
ELMOD2 Recombinant Protein (Mouse)
RP131540 100 ug Ask for price
ELMO Domain Containing Protein 2 (ELMOD2) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
ELMO Domain Containing Protein 2 (ELMOD2) Antibody
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
ELMO Domain Containing Protein 2 (ELMOD2) Antibody
abx036469-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.
ELMO Domain Containing Protein 2 (ELMOD2) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
ELMO Domain Containing Protein 2 (ELMOD2) Antibody
abx232744-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
Elmod2 ORF Vector (Rat) (pORF)
ORF066503 1.0 ug DNA
EUR 506.00
ELMOD2 ORF Vector (Human) (pORF)
ORF003531 1.0 ug DNA
EUR 95.00
Elmod2 ORF Vector (Mouse) (pORF)
ORF043847 1.0 ug DNA
EUR 506.00
Elmod2 ORF Vector (Mouse) (pORF)
ORF043848 1.0 ug DNA
EUR 506.00
ELMO Domain Containing Protein 2 (ELMOD2) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
ELMO Domain Containing Protein 2 (ELMOD2) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
ELMO Domain Containing Protein 2 (ELMOD2) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
ELMOD2 sgRNA CRISPR Lentivector set (Human)
K0675701 3 x 1.0 ug
EUR 339.00
Elmod2 sgRNA CRISPR Lentivector set (Rat)
K6608701 3 x 1.0 ug
EUR 339.00
Elmod2 sgRNA CRISPR Lentivector set (Mouse)
K3056401 3 x 1.0 ug
EUR 339.00
ELMOD2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0675702 1.0 ug DNA
EUR 154.00
ELMOD2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0675703 1.0 ug DNA
EUR 154.00
ELMOD2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0675704 1.0 ug DNA
EUR 154.00
Elmod2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6608702 1.0 ug DNA
EUR 154.00
Elmod2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6608703 1.0 ug DNA
EUR 154.00
Elmod2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6608704 1.0 ug DNA
EUR 154.00
Elmod2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3056402 1.0 ug DNA
EUR 154.00
Elmod2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3056403 1.0 ug DNA
EUR 154.00
Elmod2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3056404 1.0 ug DNA
EUR 154.00
ELMOD2 Protein Vector (Mouse) (pPB-C-His)
PV175386 500 ng
EUR 603.00
ELMOD2 Protein Vector (Mouse) (pPB-N-His)
PV175387 500 ng
EUR 603.00
ELMOD2 Protein Vector (Mouse) (pPM-C-HA)
PV175388 500 ng
EUR 603.00
ELMOD2 Protein Vector (Mouse) (pPM-C-His)
PV175389 500 ng
EUR 603.00
ELMOD2 Protein Vector (Mouse) (pPB-C-His)
PV175390 500 ng
EUR 603.00
ELMOD2 Protein Vector (Mouse) (pPB-N-His)
PV175391 500 ng
EUR 603.00
ELMOD2 Protein Vector (Mouse) (pPM-C-HA)
PV175392 500 ng
EUR 603.00
ELMOD2 Protein Vector (Mouse) (pPM-C-His)
PV175393 500 ng
EUR 603.00
ELMOD2 Protein Vector (Rat) (pPB-C-His)
PV266010 500 ng
EUR 603.00
ELMOD2 Protein Vector (Rat) (pPB-N-His)
PV266011 500 ng
EUR 603.00
ELMOD2 Protein Vector (Rat) (pPM-C-HA)
PV266012 500 ng
EUR 603.00
ELMOD2 Protein Vector (Rat) (pPM-C-His)
PV266013 500 ng
EUR 603.00
ELMOD2 Protein Vector (Human) (pPB-C-His)
PV014121 500 ng
EUR 329.00
ELMOD2 Protein Vector (Human) (pPB-N-His)
PV014122 500 ng
EUR 329.00
ELMOD2 Protein Vector (Human) (pPM-C-HA)
PV014123 500 ng
EUR 329.00
ELMOD2 Protein Vector (Human) (pPM-C-His)
PV014124 500 ng
EUR 329.00
Elmod2 3'UTR GFP Stable Cell Line
TU155770 1.0 ml Ask for price
Elmod2 3'UTR Luciferase Stable Cell Line
TU105770 1.0 ml Ask for price
Elmod2 3'UTR Luciferase Stable Cell Line
TU203937 1.0 ml Ask for price
Elmod2 3'UTR GFP Stable Cell Line
TU253937 1.0 ml Ask for price
ELMOD2 3'UTR GFP Stable Cell Line
TU056839 1.0 ml
EUR 2333.00
ELMOD2 3'UTR Luciferase Stable Cell Line
TU006839 1.0 ml
EUR 2333.00
Human ELMO domain- containing protein 2, ELMOD2 ELISA KIT
ELI-09634h 96 Tests
EUR 824.00
Human ELMO Domain Containing Protein 2 (ELMOD2) ELISA Kit
abx387128-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
Bovine ELMO domain- containing protein 2, ELMOD2 ELISA KIT
ELI-47047b 96 Tests
EUR 928.00
Mouse ELMO domain- containing protein 2, Elmod2 ELISA KIT
ELI-47048m 96 Tests
EUR 865.00
ELMOD2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0675705 3 x 1.0 ug
EUR 376.00
Elmod2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6608705 3 x 1.0 ug
EUR 376.00
Elmod2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3056405 3 x 1.0 ug
EUR 376.00
ELMOD2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0675706 1.0 ug DNA
EUR 167.00
ELMOD2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0675707 1.0 ug DNA
EUR 167.00
ELMOD2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0675708 1.0 ug DNA
EUR 167.00
Elmod2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6608706 1.0 ug DNA
EUR 167.00
Elmod2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6608707 1.0 ug DNA
EUR 167.00
Elmod2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6608708 1.0 ug DNA
EUR 167.00
Elmod2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3056406 1.0 ug DNA
EUR 167.00
Elmod2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3056407 1.0 ug DNA
EUR 167.00
Elmod2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3056408 1.0 ug DNA
EUR 167.00
Anti-Anti-SEPT6 antibody antibody
STJ11100949 100 µl
EUR 277.00
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.
Anti-Anti-SEPT9 Antibody antibody
STJ111369 100 µl
EUR 277.00
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.
Anti-Anti-SEPT11 Antibody antibody
STJ111530 100 µl
EUR 277.00
Anti-Anti-SEPT4 Antibody antibody
STJ112276 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.
Anti-Anti-SEPT2 Antibody antibody
STJ25475 100 µl
EUR 277.00
Anti-Anti-SEPT5 Antibody antibody
STJ25477 100 µl
EUR 277.00
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.
Anti-Anti-SEPT8 Antibody antibody
STJ25479 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-Anti-SEPT2 Antibody antibody
STJ28365 100 µl
EUR 277.00
Anti-Anti-SEPT7 Antibody antibody
STJ28963 100 µl
EUR 277.00
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.
Anti-Anti-MARCH9 Antibody antibody
STJ112609 100 µl
EUR 277.00
Anti-Anti-SEPT11 Antibody antibody
STJ113941 100 µl
EUR 277.00
Anti-Anti-SEPT11 Antibody antibody
STJ114081 100 µl
EUR 277.00
Anti-Anti-SEPT5 Antibody antibody
STJ114819 100 µl
EUR 277.00
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.
Anti-Anti-MARCH8 Antibody antibody
STJ114828 100 µl
EUR 277.00
Anti-Anti-SEPT7 Antibody antibody
STJ116214 100 µl
EUR 277.00
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.
Anti-Anti-SEPT8 Antibody antibody
STJ117206 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-Anti-SEPT12 Antibody antibody
STJ117759 100 µl
EUR 277.00
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-Anti-MARCH6 Antibody antibody
STJ118549 100 µl
EUR 277.00
Anti-Anti-MARCH6 Antibody antibody
STJ118550 100 µl
EUR 277.00
Anti-Anti-MARCH7 Antibody antibody
STJ118752 100 µl
EUR 277.00
Anti-Anti-SEPT3 Antibody antibody
STJ118990 100 µl
EUR 277.00
Anti-Anti-SEPT1 antibody antibody
STJ119580 100 µl
EUR 277.00
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]
Anti-Anti-DDB1 Antibody
A00333 100uL
EUR 455.00
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.80
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit
AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Leave a Reply

Your email address will not be published. Required fields are marked *