Acetylcholinesterase (AChE) polyclonal antibody from hybrid catfish

Acetylcholinesterase (AChE) polyclonal antibody from hybrid catfish (C. macrocephalus × C. gariepinus): Specification, sensitivity and cross reactivity

 

AChE (acetylcholinesterase) is mostly labeled as a particular biomarker of pesticide publicity. The purpose of this examine was to supply AChE polyclonal antibody from hybrid catfish that have been uncovered to industrial glyphosate. The hybrid catfish was uncovered to glyphosate (0.75 mL/L) for 24 h.

After that, the fish mind was dissected, AChE was extracted and purified by hydroxyapatite column chromatography and eluted with 0.2 M potassium phosphate buffer pH 6.8. This protocol gave 70% yield. Then, the mind extract was characterised utilizing 10% SDS-PAGE and Western blot probed with industrial polyclonal antibody particular to AChE (PAb-AChE). The protein, 71 kDa, was then used as an antigen to immunize mice for antibody manufacturing.

The polyclonal antibody (PAb) was characterised utilizing dot blot, Western blot and immunohistochemistry for immunolocalization of AChE in hybrid catfish uncovered to glyphosate. We discovered that the suitable dilution of antibody for each dot blot and Western blot was 1:3500, and 1:2500 for immunohistochemistry.

Cross reactivity testing confirmed that PAb-AChE can be utilized with AChE from striped snakehead fish on the similar dilution as used with AChE from hybrid catfish. It was concluded that PAb particular to hybrid catfish AChE from this work was extremely particular and delicate, and might cross-react with striped snakehead fish AChE. Thus, this polyclonal antibody could also be utilized in monitoring glyphosate publicity in hybrid catfish and striped snakehead fish.

EIF2B1 antibody
70R-17038	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal EIF2B1 antibody

EIF2B1 Antibody
1-CSB-PA623910ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EIF2B1 Antibody
1-CSB-PA623910ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

EIF2B1 Antibody
DF12392	Affbiotech	200ul	EUR 304
Description: EIF2B1 antibody detects endogenous levels of EIF2B1.

EIF2B1 antibody
70R-3849	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal EIF2B1 antibody raised against the C terminal of EIF2B1

EIF2B1 Antibody
1-CSB-PA007514GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

Eif2b1/ Rat Eif2b1 ELISA Kit
ELI-32703r	Lifescience Market	96 Tests	EUR 886

EIF2B1 Polyclonal Antibody
31370-100ul	SAB	100ul	EUR 252

EIF2B1 Polyclonal Antibody
31370-50ul	SAB	50ul	EUR 187

EIF2B1 Protein
20-abx263439	Abbexa	EUR 230.00 EUR 1609.00 EUR 328.00	1 µg 50 ug 5 ug
Shipped within 5-10 working days.

EIF2B1 siRNA
20-abx901673	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF2B1 siRNA
20-abx915139	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF2B1 siRNA
20-abx915140	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF2B1 Polyclonal Conjugated Antibody
C31370	SAB	100ul	EUR 397

EIF2B1 Blocking Peptide
33R-1107	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACBD5 antibody, catalog no. 70R-6731

EIF2B1 Blocking Peptide
DF12392-BP	Affbiotech	1mg	EUR 195

EIF2B1 cloning plasmid
CSB-CL623910HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 918 Sequence: ATGGACGACAAGGAGTTAATTGAATACTTTAAGTCTCAGATGAAAGAAGATCCTGACATGGCCTCAGCAGTGGCTGCCATCCGGACGTTGCTGGAGTTCTTGAAGAGAGATAAAGGGGAGACAATCCAGGGTCTGAGGGCGAATCTCACCAGTGCCATAGAAACCCTGTGTGGTGT Show more
Description: A cloning plasmid for the EIF2B1 gene.

EIF2B1 Rabbit pAb
A7892-100ul	Abclonal	100 ul	EUR 308

EIF2B1 Rabbit pAb
A7892-200ul	Abclonal	200 ul	EUR 459

EIF2B1 Rabbit pAb
A7892-20ul	Abclonal	20 ul	EUR 183

EIF2B1 Rabbit pAb
A7892-50ul	Abclonal	50 ul	EUR 223

pExpress-Eif2b1-r
PVT17590	Lifescience Market	2 ug	EUR 258

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

EIF2B1 protein (His tag)
80R-1781	Fitzgerald	10 ug	EUR 305
Description: Purified recombinant Human EIF2B1 protein

Human EIF2B1 ELISA KIT
ELI-09622h	Lifescience Market	96 Tests	EUR 824

Bovine EIF2B1 ELISA KIT
ELI-27647b	Lifescience Market	96 Tests	EUR 928

Mouse Eif2b1 ELISA KIT
ELI-27648m	Lifescience Market	96 Tests	EUR 865

EIF2B1 ELISA KIT|Human
EF009329	Lifescience Market	96 Tests	EUR 689

Rat EIF2B1 shRNA Plasmid
20-abx986264	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse EIF2B1 shRNA Plasmid
20-abx980609	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human EIF2B1 shRNA Plasmid
20-abx951361	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EIF2B1 Recombinant Protein (Human)
RP038725	ABM	100 ug	Ask for price

EIF2B1 Recombinant Protein (Rat)
RP199301	ABM	100 ug	Ask for price

EIF2B1 Recombinant Protein (Mouse)
RP131213	ABM	100 ug	Ask for price

Eif2b1 ORF Vector (Rat) (pORF)
ORF066435	ABM	1.0 ug DNA	EUR 506

EIF2B1 ORF Vector (Human) (pORF)
ORF012909	ABM	1.0 ug DNA	EUR 354

Eif2b1 ORF Vector (Mouse) (pORF)
ORF043739	ABM	1.0 ug DNA	EUR 506

Eif2b1 sgRNA CRISPR Lentivector set (Mouse)
K4892101	ABM	3 x 1.0 ug	EUR 339

EIF2B1 sgRNA CRISPR Lentivector set (Human)
K0665501	ABM	3 x 1.0 ug	EUR 339

Eif2b1 sgRNA CRISPR Lentivector set (Rat)
K7080801	ABM	3 x 1.0 ug	EUR 339

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody
20-abx007084	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody
20-abx112365	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (eIF2B1) Antibody
20-abx142023	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody
20-abx320993	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody
20-abx322477	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody
abx232693-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4892102	ABM	1.0 ug DNA	EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4892103	ABM	1.0 ug DNA	EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4892104	ABM	1.0 ug DNA	EUR 154

EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0665502	ABM	1.0 ug DNA	EUR 154

EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0665503	ABM	1.0 ug DNA	EUR 154

EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0665504	ABM	1.0 ug DNA	EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7080802	ABM	1.0 ug DNA	EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7080803	ABM	1.0 ug DNA	EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7080804	ABM	1.0 ug DNA	EUR 154

EIF2B1 Protein Vector (Mouse) (pPB-C-His)
PV174954	ABM	500 ng	EUR 603

EIF2B1 Protein Vector (Mouse) (pPB-N-His)
PV174955	ABM	500 ng	EUR 603

EIF2B1 Protein Vector (Mouse) (pPM-C-HA)
PV174956	ABM	500 ng	EUR 603

EIF2B1 Protein Vector (Mouse) (pPM-C-His)
PV174957	ABM	500 ng	EUR 603

EIF2B1 Protein Vector (Rat) (pPB-C-His)
PV265738	ABM	500 ng	EUR 603

EIF2B1 Protein Vector (Rat) (pPB-N-His)
PV265739	ABM	500 ng	EUR 603

EIF2B1 Protein Vector (Rat) (pPM-C-HA)
PV265740	ABM	500 ng	EUR 603

EIF2B1 Protein Vector (Rat) (pPM-C-His)
PV265741	ABM	500 ng	EUR 603

EIF2B1 Protein Vector (Human) (pPB-C-His)
PV051633	ABM	500 ng	EUR 481

EIF2B1 Protein Vector (Human) (pPB-N-His)
PV051634	ABM	500 ng	EUR 481

EIF2B1 Protein Vector (Human) (pPM-C-HA)
PV051635	ABM	500 ng	EUR 481

EIF2B1 Protein Vector (Human) (pPM-C-His)
PV051636	ABM	500 ng	EUR 481

Recombinant Human EIF2B1 Protein, GST, E.coli-100ug
QP7612-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human EIF2B1 Protein, GST, E.coli-10ug
QP7612-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human EIF2B1 Protein, GST, E.coli-1mg
QP7612-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human EIF2B1 Protein, GST, E.coli-200ug
QP7612-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human EIF2B1 Protein, GST, E.coli-500ug
QP7612-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human EIF2B1 Protein, GST, E.coli-50ug
QP7612-ec-50ug	EnQuireBio	50ug	EUR 263

Eif2b1 3'UTR GFP Stable Cell Line
TU155699	ABM	1.0 ml	Ask for price

Eif2b1 3'UTR Luciferase Stable Cell Line
TU105699	ABM	1.0 ml	Ask for price

Eif2b1 3'UTR Luciferase Stable Cell Line
TU203867	ABM	1.0 ml	Ask for price

Eif2b1 3'UTR GFP Stable Cell Line
TU253867	ABM	1.0 ml	Ask for price

EIF2B1 3'UTR GFP Stable Cell Line
TU056709	ABM	1.0 ml	EUR 1394

EIF2B1 3'UTR Luciferase Stable Cell Line
TU006709	ABM	1.0 ml	EUR 1394

EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV703599	ABM	1.0 ug DNA	EUR 450

EIF2B1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV703603	ABM	1.0 ug DNA	EUR 450

EIF2B1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV703604	ABM	1.0 ug DNA	EUR 450

EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV677041	ABM	1.0 ug DNA	EUR 514

EIF2B1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV677045	ABM	1.0 ug DNA	EUR 514

EIF2B1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV677046	ABM	1.0 ug DNA	EUR 514

Human Translation initiation factor eIF-2B subunit alpha (EIF2B1)
1-CSB-EP623910HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 60.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Translation initiation factor eIF-2B subunit alpha(EIF2B1) expressed in E.coli

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4892105	ABM	3 x 1.0 ug	EUR 376

EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0665505	ABM	3 x 1.0 ug	EUR 376

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7080805	ABM	3 x 1.0 ug	EUR 376

Human Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) ELISA Kit
abx387084-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4892106	ABM	1.0 ug DNA	EUR 167

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4892107	ABM	1.0 ug DNA	EUR 167

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4892108	ABM	1.0 ug DNA	EUR 167

EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV703600	ABM	1.0 ug DNA	EUR 450

EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV703601	ABM	1.0 ug DNA	EUR 508

EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV703602	ABM	1.0 ug DNA	EUR 508

EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV677042	ABM	1.0 ug DNA	EUR 514

EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV677043	ABM	1.0 ug DNA	EUR 572

EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV677044	ABM	1.0 ug DNA	EUR 572

EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0665506	ABM	1.0 ug DNA	EUR 167

EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0665507	ABM	1.0 ug DNA	EUR 167

EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0665508	ABM	1.0 ug DNA	EUR 167

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7080806	ABM	1.0 ug DNA	EUR 167

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7080807	ABM	1.0 ug DNA	EUR 167

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7080808	ABM	1.0 ug DNA	EUR 167

EIF2B1 Eukaryotic Translation Initiation Factor 2B Subunit 1 Alpha Human Recombinant Protein
PROTQ14232	BosterBio	Regular: 5ug	EUR 317
Description: EIF2B1 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 325 amino acids (1-305 a.a.) and having a molecular mass of 35.8kDa.;EIF2B1 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

 

Era of Excessive Affinity Anti-Peptide Polyclonal Antibodies Recognizing Goat α _s1-Casein

 

The chemical, technological and allergy properties of goat’s milk are considerably affected by the extent of α_s1-casein. Detection and quantification of α_s1-casein requires high-specificity strategies to beat high-sequence similarity between this protein and others within the casein household. Unavailability of antibodies with excessive affinity and specificity in direction of goat α_s1-casein hinders the event of immuno-based analytical strategies comparable to enzyme-linked immunosorbent assay (ELISA) and biosensors.

Right here, we report the era of polyclonal antibodies (or immunoglobulins, IgGs) raised in direction of goat α_s1-casein N- (Nter) and C-terminal (Cter) peptide sequences. The Nter and Cter peptides of goat α_s1-casein have been immunized in rabbits for the era of antisera, which have been purified utilizing protein G affinity chromatography. The binding affinity of the antisera and purified IgGs have been examined and in contrast utilizing oblique ELISA, the place peptide-BSA conjugates and goat α_s1-casein have been used because the coating antigens.

The Nter antiserum displayed greater titer than Cter antiserum, at 1/64,000 and 1/32,000 dilutions, respectively. The purification step additional yielded 0.5 mg/mL of purified IgGs from Three mL of antisera. The purified Nter IgG confirmed a considerably (p < 0.05) greater binding affinity in direction of peptide-BSA and goat α_s1-casein, with decrease Okay_d worth at 5.063 × 10^-3 μM in comparison with 9.046 × 10^-3 μM for the Cter IgG. A cross-reactivity take a look at confirmed that there was no binding in neither Nter nor Cter IgGs in direction of protein extracts from the milk of cow, buffalo, horse and camel. Excessive-quality antibodies generated will permit additional improvement of immuno-based analytical strategies and future in vitro research to be carried out on goat α_s1-casein.

 

Expression of HPV16 E6 recombinant protein and preparation of its rabbit polyclonal antibody

 

Goal To specific E6 protein of human papillomavirus (HPV) sort 16 in prokaryotic expression system and put together its polyclonal antibody. Strategies HPV16 E6 gene was obtained from Siha cells by PCR and cloned into pET21a(+) vector to assemble the recombinant plasmid pET21a(+)/HPV16 E6 that was confirmed by sequencing. The recombinant plasmid pET21a(+)/HPV16 E6 was reworked into E. coli BL21 (DE3). The HPV16 E6-His tag recombinant protein was expressed after the induction of isopropyl beta-D-1-thiogalactopyranoside (IPTG), purified by Ni-NTA affinity chromatography, after which analyzed by Western blot evaluation. The purified HPV16 E6 recombinant protein was used to immunize Japanese white rabbits to organize polyclonal antibody.

The titer of the serum polyclonal antibody was decided by ELISA. The specificity of the polyclonal antibody was analyzed by Western blotting and immunofluorescence. Outcomes The recombinant plasmid pET21a(+)/HPV16 E6 was efficiently constructed and confirmed by sequencing.

 

After the recombinant plasmid pET21a(+)/HPV16 E6 was reworked into E. coli BL21 (DE3), the recombinant HPV16 E6 protein was expressed and purified by affinity chromatography. The polyclonal antibody at a titer of 1:40 000 was obtained by immunizing Japanese big-ear white rabbit with the purified recombinant HPV16 E6 protein, and its specificity was confirmed by Western blotting and immunofluorescence assay. Conclusion HPV16 E6 recombinant protein was efficiently expressed and the rabbit polyclonal antibody towards HPV16 E6 recombinant protein was ready.

Anti-PSMA Antibody
A02846	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal PSMA Antibody. Validated in WB and tested in Human.

PSMA Conjugated Antibody
C21694	SAB	100ul	EUR 397

Anti-PSMA antibody
STJ190089	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Mouse monoclonal to PSMA (2A2)

anti-PSMA
YF-PA23731	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to PSMA

Polyclonal FOLH1 / PSMA Antibody
AMM04576G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FOLH1 / PSMA . This antibody is tested and proven to work in the following applications:

anti- PSMA/GCPII antibody
FNab06860	FN Test	100µg	EUR 548.75
Immunogen: folate hydrolase(prostate-specific membrane antigen) 1 Uniprot ID: Q04609 Research Area: Cancer, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against PSMA/GCPII

Anti-PSMA/GCPII antibody
PAab06860	Lifescience Market	100 ug	EUR 386

Anti-PSMA Purified
11-532-C025	ExBio	0.025 mg	EUR 126

Anti-PSMA Purified
11-532-C100	ExBio	0.1 mg	EUR 213

Anti-PSMA Purified
11-539-C025	ExBio	0.025 mg	EUR 126

Anti-PSMA Purified
11-539-C100	ExBio	0.1 mg	EUR 213

Anti-PSMA PE
1P-539-C025	ExBio	0.025 mg	EUR 190

Anti-PSMA PE
1P-539-C100	ExBio	0.1 mg	EUR 340

Monoclonal PSMA Antibody, Clone: EP3254
AMR09576G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human PSMA. The antibodies are raised in Rabbit and are from clone EP3254. This antibody is applicable in WB and IF

Monoclonal PSMA Antibody, Clone: EP3253
AMR09577G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human PSMA. The antibodies are raised in Rabbit and are from clone EP3253. This antibody is applicable in WB

Anti-PSMA Rabbit Monoclonal Antibody
M02846	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal PSMA Antibody. Validated in IP, IHC, WB and tested in Human.

Anti-PSMA Alexa Fluor488
A4-539-C025	ExBio	0.025 mg	EUR 227

Anti-PSMA Alexa Fluor488
A4-539-C100	ExBio	0.1 mg	EUR 414

Prostate Specific Membrane Antigen (PSMA) Antibody
abx414664-01mg	Abbexa	0.1 mg	EUR 439
Shipped within 1 week.

PSMA/GCPII ELISA KIT|Human
EF002101	Lifescience Market	96 Tests	EUR 689

Anti-PSMA Rabbit Monoclonal Antibody, Clone#RM327
M02846-1	BosterBio	100uL	EUR 385
Description: Anti-PSMA Rabbit Monoclonal Antibody, Clone#RM327 tested in WB, IHC, reactive to Human

Mouse Anti-Human PSMA monoclonal antibody, clone JID767
CABT-L3006-100uL500uL	Creative Diagnostics	100 uL, 500 uL	EUR 502

Monoclonal FOLH1 / PSMA Antibody (clone 3H5), Clone: 3H5
AMM04578G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human FOLH1 / PSMA (clone 3H5). The antibodies are raised in Mouse and are from clone 3H5. This antibody is applicable in WB and IHC-P, IF, Flo

Monoclonal FOLH1 / PSMA Antibody (clone 5C4), Clone: 5C4
AMM04579G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human FOLH1 / PSMA (clone 5C4). The antibodies are raised in Mouse and are from clone 5C4. This antibody is applicable in WB and IHC-P, Flo

PSMA Aptamer, unlabeled (A10.L), RNA Aptamer
AR-301-U	Alpha Diagnostics	Custom	Ask for price

Recombinant Anti-CD3 x Anti-PSMA Bispecific Antibody (Tandem scFv)
BSFV-102-100ug	Creative Biolabs	100μg	EUR 3560
Description: A bispecific antibody that is expressed as an anti-CD3 scFv fused with an anti-PSMA scFv, contains a His-tag at the C/N terminus for affinity purification. This BsAb can retarget T cells to tumor cells. It is designed for the research of Prostate cancer therapy.

Recombinant Anti-CD3 x Anti-PSMA Bispecific Antibody (Tandem scFv)
BSFV-102-50ug	Creative Biolabs	50μg	EUR 2039
Description: A bispecific antibody that is expressed as an anti-CD3 scFv fused with an anti-PSMA scFv, contains a His-tag at the C/N terminus for affinity purification. This BsAb can retarget T cells to tumor cells. It is designed for the research of Prostate cancer therapy.

Monoclonal FOLH1 / PSMA Antibody (aa117-351, clone K1H7), Clone: K1H7
AMM04577G	Leading Biology	0.05mg	EUR 484
Description: A Monoclonal antibody against Human FOLH1 / PSMA (aa117-351, clone K1H7). The antibodies are raised in Mouse and are from clone K1H7. This antibody is applicable in WB and IHC-P, E

Monoclonal FOLH1 / PSMA Antibody (clone Y-PSMA1), Clone: Y-PSMA1
AMM04580G	Leading Biology	0.05mg	EUR 484
Description: A Monoclonal antibody against Human FOLH1 / PSMA (clone Y-PSMA1). The antibodies are raised in Mouse and are from clone Y-PSMA1. This antibody is applicable in WB and IHC-P, IF, E, IHC-Fr

Anti-PSMA (Prostate specific membrane antigen) Rabbit Monoclonal Antibody (RM327)
A1841-50	Biovision		EUR 311

Human Prostate specific membrane antigen (PSMA) ELISA Kit
abx352263-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human PSMA(Prostate specific membrane antigen)ELISA Kit
STJ150476	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of PSMA in human serum, plasma and other biological fluids

ELISA kit for Human PSMA (Prostate specific membrane antigen)
E-EL-H5413	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PSMA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PSMA. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PSMA (Prostate specific membrane antigen) in samples from Serum, Plasma, Cell supernatant

Human CellExp? PSMA / FOLH1, C-His Tag, human recombinant
P1304-100	Biovision		Ask for price

Human CellExp? PSMA / FOLH1, C-His Tag, human recombinant
P1304-25	Biovision		EUR 1300

Human CellExp? PSMA / FOLH1, C-His Tag, human recombinant
P1304-5	Biovision		EUR 370

H2B Antibody Antibody
AF4659	Affbiotech	200ul	EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody
ABD2911	Lifescience Market	100 ug	EUR 438

anti- Antibody^Polyclonal antibody control antibody
LSMab09882	Lifescience Market	100 ug	EUR 438

Ly1 Antibody Reactive (LYAR) Antibody
20-abx008109	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody
20-abx004855	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
20-abx123734	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody
abx036399-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
20-abx014333	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
abx033330-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
abx033330-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody
20-abx319900	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody
20-abx319901	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody
20-abx319905	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody
20-abx319913	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
abx234901-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Ly1 Antibody Reactive (LYAR) Antibody
20-abx324434	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
20-abx311665	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody
abx230204-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Anti-Anti-SEPT6 antibody antibody
STJ11100949	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody
STJ111369	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody
STJ111530	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT4 Antibody antibody
STJ112276	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody
STJ25475	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT5 Antibody antibody
STJ25477	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody
STJ25479	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody
STJ28365	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT7 Antibody antibody
STJ28963	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody
STJ112609	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT11 Antibody antibody
STJ113941	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT11 Antibody antibody
STJ114081	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT5 Antibody antibody
STJ114819	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody
STJ114828	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT7 Antibody antibody
STJ116214	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody
STJ117206	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody
STJ117759	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody
STJ118549	St John's Laboratory	100 µl	EUR 277

Anti-Anti-MARCH6 Antibody antibody
STJ118550	St John's Laboratory	100 µl	EUR 277

Anti-Anti-MARCH7 Antibody antibody
STJ118752	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT3 Antibody antibody
STJ118990	St John's Laboratory	100 µl	EUR 277

Anti-Anti-SEPT1 antibody antibody
STJ119580	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Cytokeratin 7 antibody-Cytoskeleton Marker Antibody
48169-100ul	SAB	100ul	EUR 333

Cytokeratin 7 antibody-Cytoskeleton Marker Antibody
48169-50ul	SAB	50ul	EUR 239

Antibody Pair to ApoA-V antibody
10R-1876	Fitzgerald	100 ul	EUR 651
Description: Mouse monoclonal Antibody Pair to ApoA-V antibody

Anti CD22 Antibody: CD22 Monoclonal Antibody
065-A-01mg	Virogen	0,1 mg	EUR 267.5
Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody

Anti CD22 Antibody: CD22 Monoclonal Antibody
065-A-1000ug	Virogen	1000 ug	EUR 1282.5
Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody

Hepatitis C Virus Antibody (HCV) Antibody
abx023924-1mg	Abbexa	1 mg	EUR 1205
Shipped within 5-10 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody
20-abx103034	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody
20-abx103035	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody
20-abx103036	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Monoclonal NGF/proNGF Neutralizing Antibody Antibody
AMM06679G	Leading Biology	0.05mg	EUR 528
Description: A Monoclonal antibody against Human NGF/proNGF Neutralizing. The antibodies are raised in Mouse. This antibody is applicable in E

Anti Deoxyribonucleic Acid Antibody (DNA) Antibody
abx411057-50ug	Abbexa	50 ug	EUR 592
Shipped within 1 week.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)
20-abx319902	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)
20-abx319903	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)
20-abx319904	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)
20-abx319906	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)
20-abx319907	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)
20-abx319908	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)
20-abx319914	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)
20-abx319915	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)
20-abx319916	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)
20-abx319929	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)
20-abx319930	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)
20-abx319931	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Glycoprotein 210 Antibody (gp210) Antibody
abx233571-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Ly1 Antibody Reactive (LYAR) Antibody (HRP)
20-abx311666	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody (FITC)
20-abx311667	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody (Biotin)
20-abx311668	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Goat anti- human Antibody^Polyclonal antibody
LSMab09896	Lifescience Market	100 ug	EUR 438

Antibody for Human alpha Tubulin Antibody
SPC-692D	Stressmarq	0.1mg	EUR 354
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is unconjugated.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A390	Stressmarq	0.1mg	EUR 401
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 390.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A488	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 488.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A565	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 565.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A594	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 594.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A633	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 633.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A655	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 655.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A680	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 680.

Antibody for Human alpha Tubulin Antibody
SPC-692D-A700	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 700.

Antibody for Human alpha Tubulin Antibody
SPC-692D-ALP	Stressmarq	0.1mg	EUR 394
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Alkaline Phosphatase.

Antibody for Human alpha Tubulin Antibody
SPC-692D-APC	Stressmarq	0.1mg	EUR 399
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to APC .

Antibody for Human alpha Tubulin Antibody
SPC-692D-APCCY7	Stressmarq	0.1mg	EUR 471
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to APC/Cy7.

Antibody for Human alpha Tubulin Antibody
SPC-692D-BI	Stressmarq	0.1mg	EUR 396
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Biotin.

Antibody for Human alpha Tubulin Antibody
SPC-692D-DY350	Stressmarq	0.1mg	EUR 414
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 350.

Antibody for Human alpha Tubulin Antibody
SPC-692D-DY405	Stressmarq	0.1mg	EUR 403
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 405.

Antibody for Human alpha Tubulin Antibody
SPC-692D-DY488	Stressmarq	0.1mg	EUR 393
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 488.

Antibody for Human alpha Tubulin Antibody
SPC-692D-DY594	Stressmarq	0.1mg	EUR 395
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 594.

Antibody for Human alpha Tubulin Antibody
SPC-692D-DY633	Stressmarq	0.1mg	EUR 390
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 633.

Antibody for Human alpha Tubulin Antibody
SPC-692D-FITC	Stressmarq	0.1mg	EUR 392
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to FITC.

Antibody for Human alpha Tubulin Antibody
SPC-692D-HRP	Stressmarq	0.1mg	EUR 388
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to HRP.

Antibody for Human alpha Tubulin Antibody
SPC-692D-P594	Stressmarq	0.1mg	EUR 407
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to PE/ATTO 594.

Antibody for Human alpha Tubulin Antibody
SPC-692D-PCP	Stressmarq	0.1mg	EUR 399
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to PerCP.

Antibody for Human alpha Tubulin Antibody
SPC-692D-RPE	Stressmarq	0.1mg	EUR 397
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to RPE .

Antibody for Human alpha Tubulin Antibody
SPC-692D-STR	Stressmarq	0.1mg	EUR 398
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Streptavidin.

Antibody for Human alpha Tubulin Antibody
SPC-692S	Stressmarq	0.012mg	EUR 65
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is unconjugated.

Anti-IgG1 Negative Control Antibody antibody
STJ16100881	St John's Laboratory	1 mL	EUR 478

Anti-Noelin Antibody BIOTIN Antibody BIOTIN
STJ501938	St John's Laboratory	100 µg	EUR 586

Anti-Noelin Antibody FITC Antibody FITC
STJ501939	St John's Laboratory	100 µg	EUR 586

Anti-Noelin Antibody BIOTIN Antibody BIOTIN
STJ501940	St John's Laboratory	100 µg	EUR 586

Anti-Noelin Antibody FITC Antibody FITC
STJ501941	St John's Laboratory	100 µg	EUR 586

Bad Antibody
3030-100	Biovision		EUR 338

BAK1 Antibody
3031-100	Biovision		EUR 316

BAK1 Antibody
3031-30T	Biovision		EUR 146

Bax Antibody
3032-100	Biovision		EUR 316

Bax Antibody
3032-30T	Biovision		EUR 146

p53 Antibody
3036R-100	Biovision		EUR 316

p53 Antibody
3036R-30T	Biovision		EUR 146

RAIDD Antibody
3037-100	Biovision		EUR 316

RAIDD Antibody
3037-30T	Biovision		EUR 146

FADD Antibody
3039-100	Biovision		EUR 349

FADD Antibody
3039-30T	Biovision		EUR 146

Bok Antibody
3043-100	Biovision		EUR 359

PBR Antibody
3044-100	Biovision		EUR 376

PBR Antibody
3044-30T	Biovision		EUR 146

TRAIL Antibody
3045-100	Biovision		EUR 316

TRAIL Antibody
3045-30T	Biovision		EUR 146

DFF45 Antibody
3048-100	Biovision		EUR 338

DFF40 Antibody
3049-100	Biovision		EUR 338