Acetylcholinesterase (AChE) polyclonal antibody from hybrid catfish


i-dna

Acetylcholinesterase (AChE) polyclonal antibody from hybrid catfish (C. macrocephalus × C. gariepinus): Specification, sensitivity and cross reactivity

 

AChE (acetylcholinesterase) is mostly labeled as a particular biomarker of pesticide publicity. The purpose of this examine was to supply AChE polyclonal antibody from hybrid catfish that have been uncovered to industrial glyphosate. The hybrid catfish was uncovered to glyphosate (0.75 mL/L) for 24 h.

After that, the fish mind was dissected, AChE was extracted and purified by hydroxyapatite column chromatography and eluted with 0.2 M potassium phosphate buffer pH 6.8. This protocol gave 70% yield. Then, the mind extract was characterised utilizing 10% SDS-PAGE and Western blot probed with industrial polyclonal antibody particular to AChE (PAb-AChE). The protein, 71 kDa, was then used as an antigen to immunize mice for antibody manufacturing.

The polyclonal antibody (PAb) was characterised utilizing dot blot, Western blot and immunohistochemistry for immunolocalization of AChE in hybrid catfish uncovered to glyphosate. We discovered that the suitable dilution of antibody for each dot blot and Western blot was 1:3500, and 1:2500 for immunohistochemistry.

Cross reactivity testing confirmed that PAb-AChE can be utilized with AChE from striped snakehead fish on the similar dilution as used with AChE from hybrid catfish. It was concluded that PAb particular to hybrid catfish AChE from this work was extremely particular and delicate, and might cross-react with striped snakehead fish AChE. Thus, this polyclonal antibody could also be utilized in monitoring glyphosate publicity in hybrid catfish and striped snakehead fish.

i-dna

i-dna

EIF2B1 antibody

70R-17038 50 ul
EUR 435.00
Description: Rabbit polyclonal EIF2B1 antibody

EIF2B1 Antibody

1-CSB-PA623910ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EIF2B1 Antibody

1-CSB-PA623910ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

EIF2B1 Antibody

DF12392 200ul
EUR 304.00
Description: EIF2B1 antibody detects endogenous levels of EIF2B1.

EIF2B1 antibody

70R-3849 50 ug
EUR 467.00
Description: Rabbit polyclonal EIF2B1 antibody raised against the C terminal of EIF2B1

EIF2B1 Antibody

1-CSB-PA007514GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

Eif2b1/ Rat Eif2b1 ELISA Kit

ELI-32703r 96 Tests
EUR 886.00

EIF2B1 Polyclonal Antibody

31370-100ul 100ul
EUR 252.00

EIF2B1 Polyclonal Antibody

31370-50ul 50ul
EUR 187.00

EIF2B1 Protein

20-abx263439
  • EUR 230.00
  • EUR 1609.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

EIF2B1 siRNA

20-abx901673
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EIF2B1 siRNA

20-abx915139
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EIF2B1 siRNA

20-abx915140
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EIF2B1 Polyclonal Conjugated Antibody

C31370 100ul
EUR 397.00

EIF2B1 Blocking Peptide

33R-1107 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACBD5 antibody, catalog no. 70R-6731

EIF2B1 Blocking Peptide

DF12392-BP 1mg
EUR 195.00

EIF2B1 cloning plasmid

CSB-CL623910HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 918
  • Sequence: ATGGACGACAAGGAGTTAATTGAATACTTTAAGTCTCAGATGAAAGAAGATCCTGACATGGCCTCAGCAGTGGCTGCCATCCGGACGTTGCTGGAGTTCTTGAAGAGAGATAAAGGGGAGACAATCCAGGGTCTGAGGGCGAATCTCACCAGTGCCATAGAAACCCTGTGTGGTGT
  • Show more
Description: A cloning plasmid for the EIF2B1 gene.

EIF2B1 Rabbit pAb

A7892-100ul 100 ul
EUR 308.00

EIF2B1 Rabbit pAb

A7892-200ul 200 ul
EUR 459.00

EIF2B1 Rabbit pAb

A7892-20ul 20 ul
EUR 183.00

EIF2B1 Rabbit pAb

A7892-50ul 50 ul
EUR 223.00

pExpress-Eif2b1-r

PVT17590 2 ug
EUR 258.00

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280.00

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280.00

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280.00

EIF2B1 protein (His tag)

80R-1781 10 ug
EUR 305.00
Description: Purified recombinant Human EIF2B1 protein

Human EIF2B1 ELISA KIT

ELI-09622h 96 Tests
EUR 824.00

Bovine EIF2B1 ELISA KIT

ELI-27647b 96 Tests
EUR 928.00

Mouse Eif2b1 ELISA KIT

ELI-27648m 96 Tests
EUR 865.00

EIF2B1 ELISA KIT|Human

EF009329 96 Tests
EUR 689.00

Rat EIF2B1 shRNA Plasmid

20-abx986264
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse EIF2B1 shRNA Plasmid

20-abx980609
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human EIF2B1 shRNA Plasmid

20-abx951361
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

EIF2B1 Recombinant Protein (Human)

RP038725 100 ug Ask for price

EIF2B1 Recombinant Protein (Rat)

RP199301 100 ug Ask for price

EIF2B1 Recombinant Protein (Mouse)

RP131213 100 ug Ask for price

Eif2b1 ORF Vector (Rat) (pORF)

ORF066435 1.0 ug DNA
EUR 506.00

EIF2B1 ORF Vector (Human) (pORF)

ORF012909 1.0 ug DNA
EUR 354.00

Eif2b1 ORF Vector (Mouse) (pORF)

ORF043739 1.0 ug DNA
EUR 506.00

Eif2b1 sgRNA CRISPR Lentivector set (Mouse)

K4892101 3 x 1.0 ug
EUR 339.00

EIF2B1 sgRNA CRISPR Lentivector set (Human)

K0665501 3 x 1.0 ug
EUR 339.00

Eif2b1 sgRNA CRISPR Lentivector set (Rat)

K7080801 3 x 1.0 ug
EUR 339.00

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody

20-abx007084
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody

20-abx112365
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (eIF2B1) Antibody

20-abx142023
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody

20-abx320993
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody

20-abx322477
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody

abx232693-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4892102 1.0 ug DNA
EUR 154.00

Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4892103 1.0 ug DNA
EUR 154.00

Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4892104 1.0 ug DNA
EUR 154.00

EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0665502 1.0 ug DNA
EUR 154.00

EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0665503 1.0 ug DNA
EUR 154.00

EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0665504 1.0 ug DNA
EUR 154.00

Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7080802 1.0 ug DNA
EUR 154.00

Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7080803 1.0 ug DNA
EUR 154.00

Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7080804 1.0 ug DNA
EUR 154.00

EIF2B1 Protein Vector (Mouse) (pPB-C-His)

PV174954 500 ng
EUR 603.00

EIF2B1 Protein Vector (Mouse) (pPB-N-His)

PV174955 500 ng
EUR 603.00

EIF2B1 Protein Vector (Mouse) (pPM-C-HA)

PV174956 500 ng
EUR 603.00

EIF2B1 Protein Vector (Mouse) (pPM-C-His)

PV174957 500 ng
EUR 603.00

EIF2B1 Protein Vector (Rat) (pPB-C-His)

PV265738 500 ng
EUR 603.00

EIF2B1 Protein Vector (Rat) (pPB-N-His)

PV265739 500 ng
EUR 603.00

EIF2B1 Protein Vector (Rat) (pPM-C-HA)

PV265740 500 ng
EUR 603.00

EIF2B1 Protein Vector (Rat) (pPM-C-His)

PV265741 500 ng
EUR 603.00

EIF2B1 Protein Vector (Human) (pPB-C-His)

PV051633 500 ng
EUR 481.00

EIF2B1 Protein Vector (Human) (pPB-N-His)

PV051634 500 ng
EUR 481.00

EIF2B1 Protein Vector (Human) (pPM-C-HA)

PV051635 500 ng
EUR 481.00

EIF2B1 Protein Vector (Human) (pPM-C-His)

PV051636 500 ng
EUR 481.00

Recombinant Human EIF2B1 Protein, GST, E.coli-100ug

QP7612-ec-100ug 100ug
EUR 408.00

Recombinant Human EIF2B1 Protein, GST, E.coli-10ug

QP7612-ec-10ug 10ug
EUR 200.00

Recombinant Human EIF2B1 Protein, GST, E.coli-1mg

QP7612-ec-1mg 1mg
EUR 1632.00

Recombinant Human EIF2B1 Protein, GST, E.coli-200ug

QP7612-ec-200ug 200ug
EUR 634.00

Recombinant Human EIF2B1 Protein, GST, E.coli-500ug

QP7612-ec-500ug 500ug
EUR 1060.00

Recombinant Human EIF2B1 Protein, GST, E.coli-50ug

QP7612-ec-50ug 50ug
EUR 263.00

Eif2b1 3'UTR GFP Stable Cell Line

TU155699 1.0 ml Ask for price

Eif2b1 3'UTR Luciferase Stable Cell Line

TU105699 1.0 ml Ask for price

Eif2b1 3'UTR Luciferase Stable Cell Line

TU203867 1.0 ml Ask for price

Eif2b1 3'UTR GFP Stable Cell Line

TU253867 1.0 ml Ask for price

EIF2B1 3'UTR GFP Stable Cell Line

TU056709 1.0 ml
EUR 1394.00

EIF2B1 3'UTR Luciferase Stable Cell Line

TU006709 1.0 ml
EUR 1394.00

EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV703599 1.0 ug DNA
EUR 450.00

EIF2B1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV703603 1.0 ug DNA
EUR 450.00

EIF2B1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV703604 1.0 ug DNA
EUR 450.00

EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV677041 1.0 ug DNA
EUR 514.00

EIF2B1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV677045 1.0 ug DNA
EUR 514.00

EIF2B1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV677046 1.0 ug DNA
EUR 514.00

Human Translation initiation factor eIF-2B subunit alpha (EIF2B1)

1-CSB-EP623910HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 60.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Translation initiation factor eIF-2B subunit alpha(EIF2B1) expressed in E.coli

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4892105 3 x 1.0 ug
EUR 376.00

EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0665505 3 x 1.0 ug
EUR 376.00

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7080805 3 x 1.0 ug
EUR 376.00

Human Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) ELISA Kit

abx387084-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4892106 1.0 ug DNA
EUR 167.00

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4892107 1.0 ug DNA
EUR 167.00

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4892108 1.0 ug DNA
EUR 167.00

EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV703600 1.0 ug DNA
EUR 450.00

EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV703601 1.0 ug DNA
EUR 508.00

EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV703602 1.0 ug DNA
EUR 508.00

EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV677042 1.0 ug DNA
EUR 514.00

EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV677043 1.0 ug DNA
EUR 572.00

EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV677044 1.0 ug DNA
EUR 572.00

EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0665506 1.0 ug DNA
EUR 167.00

EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0665507 1.0 ug DNA
EUR 167.00

EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0665508 1.0 ug DNA
EUR 167.00

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7080806 1.0 ug DNA
EUR 167.00

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7080807 1.0 ug DNA
EUR 167.00

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7080808 1.0 ug DNA
EUR 167.00

EIF2B1 Eukaryotic Translation Initiation Factor 2B Subunit 1 Alpha Human Recombinant Protein

PROTQ14232 Regular: 5ug
EUR 317.00
Description: EIF2B1 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 325 amino acids (1-305 a.a.) and having a molecular mass of 35.8kDa.;EIF2B1 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

 

Era of Excessive Affinity Anti-Peptide Polyclonal Antibodies Recognizing Goat α s1-Casein

 

The chemical, technological and allergy properties of goat’s milk are considerably affected by the extent of αs1-casein. Detection and quantification of αs1-casein requires high-specificity strategies to beat high-sequence similarity between this protein and others within the casein household. Unavailability of antibodies with excessive affinity and specificity in direction of goat αs1-casein hinders the event of immuno-based analytical strategies comparable to enzyme-linked immunosorbent assay (ELISA) and biosensors.

Right here, we report the era of polyclonal antibodies (or immunoglobulins, IgGs) raised in direction of goat αs1-casein N- (Nter) and C-terminal (Cter) peptide sequences. The Nter and Cter peptides of goat αs1-casein have been immunized in rabbits for the era of antisera, which have been purified utilizing protein G affinity chromatography. The binding affinity of the antisera and purified IgGs have been examined and in contrast utilizing oblique ELISA, the place peptide-BSA conjugates and goat αs1-casein have been used because the coating antigens.

The Nter antiserum displayed greater titer than Cter antiserum, at 1/64,000 and 1/32,000 dilutions, respectively. The purification step additional yielded 0.5 mg/mL of purified IgGs from Three mL of antisera. The purified Nter IgG confirmed a considerably (p < 0.05) greater binding affinity in direction of peptide-BSA and goat αs1-casein, with decrease Okayd worth at 5.063 × 10-3 μM in comparison with 9.046 × 10-3 μM for the Cter IgG. A cross-reactivity take a look at confirmed that there was no binding in neither Nter nor Cter IgGs in direction of protein extracts from the milk of cow, buffalo, horse and camel. Excessive-quality antibodies generated will permit additional improvement of immuno-based analytical strategies and future in vitro research to be carried out on goat αs1-casein.

 

Expression of HPV16 E6 recombinant protein and preparation of its rabbit polyclonal antibody

 

Goal To specific E6 protein of human papillomavirus (HPV) sort 16 in prokaryotic expression system and put together its polyclonal antibody. Strategies HPV16 E6 gene was obtained from Siha cells by PCR and cloned into pET21a(+) vector to assemble the recombinant plasmid pET21a(+)/HPV16 E6 that was confirmed by sequencing. The recombinant plasmid pET21a(+)/HPV16 E6 was reworked into E. coli BL21 (DE3). The HPV16 E6-His tag recombinant protein was expressed after the induction of isopropyl beta-D-1-thiogalactopyranoside (IPTG), purified by Ni-NTA affinity chromatography, after which analyzed by Western blot evaluation. The purified HPV16 E6 recombinant protein was used to immunize Japanese white rabbits to organize polyclonal antibody.

The titer of the serum polyclonal antibody was decided by ELISA. The specificity of the polyclonal antibody was analyzed by Western blotting and immunofluorescence. Outcomes The recombinant plasmid pET21a(+)/HPV16 E6 was efficiently constructed and confirmed by sequencing.

 

After the recombinant plasmid pET21a(+)/HPV16 E6 was reworked into E. coli BL21 (DE3), the recombinant HPV16 E6 protein was expressed and purified by affinity chromatography. The polyclonal antibody at a titer of 1:40 000 was obtained by immunizing Japanese big-ear white rabbit with the purified recombinant HPV16 E6 protein, and its specificity was confirmed by Western blotting and immunofluorescence assay. Conclusion HPV16 E6 recombinant protein was efficiently expressed and the rabbit polyclonal antibody towards HPV16 E6 recombinant protein was ready.

Anti-PSMA Antibody

A02846 100ul
EUR 397.00
Description: Rabbit Polyclonal PSMA Antibody. Validated in WB and tested in Human.

PSMA Conjugated Antibody

C21694 100ul
EUR 397.00

Anti-PSMA antibody

STJ190089 200 µl
EUR 197.00
Description: Unconjugated Mouse monoclonal to PSMA (2A2)

anti-PSMA

YF-PA23731 50 ul
EUR 334.00
Description: Mouse polyclonal to PSMA

Polyclonal FOLH1 / PSMA Antibody

AMM04576G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FOLH1 / PSMA . This antibody is tested and proven to work in the following applications:

anti- PSMA/GCPII antibody

FNab06860 100µg
EUR 548.75
  • Immunogen: folate hydrolase(prostate-specific membrane antigen) 1
  • Uniprot ID: Q04609
  • Research Area: Cancer, Immunology, Cardiovascular, Metabolism
Description: Antibody raised against PSMA/GCPII

Anti-PSMA/GCPII antibody

PAab06860 100 ug
EUR 386.00

Anti-PSMA Purified

11-532-C025 0.025 mg
EUR 126.00

Anti-PSMA Purified

11-532-C100 0.1 mg
EUR 213.00

Anti-PSMA Purified

11-539-C025 0.025 mg
EUR 126.00

Anti-PSMA Purified

11-539-C100 0.1 mg
EUR 213.00

Anti-PSMA PE

1P-539-C025 0.025 mg
EUR 190.00

Anti-PSMA PE

1P-539-C100 0.1 mg
EUR 340.00

Monoclonal PSMA Antibody, Clone: EP3254

AMR09576G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human PSMA. The antibodies are raised in Rabbit and are from clone EP3254. This antibody is applicable in WB and IF

Monoclonal PSMA Antibody, Clone: EP3253

AMR09577G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human PSMA. The antibodies are raised in Rabbit and are from clone EP3253. This antibody is applicable in WB

Anti-PSMA Rabbit Monoclonal Antibody

M02846 100ug/vial
EUR 397.00
Description: Rabbit Monoclonal PSMA Antibody. Validated in IP, IHC, WB and tested in Human.

Anti-PSMA Alexa Fluor488

A4-539-C025 0.025 mg
EUR 227.00

Anti-PSMA Alexa Fluor488

A4-539-C100 0.1 mg
EUR 414.00

Prostate Specific Membrane Antigen (PSMA) Antibody

abx414664-01mg 0.1 mg
EUR 439.00
  • Shipped within 1 week.

PSMA/GCPII ELISA KIT|Human

EF002101 96 Tests
EUR 689.00

Anti-PSMA Rabbit Monoclonal Antibody, Clone#RM327

M02846-1 100uL
EUR 385.00
Description: Anti-PSMA Rabbit Monoclonal Antibody, Clone#RM327 tested in WB, IHC, reactive to Human

Mouse Anti-Human PSMA monoclonal antibody, clone JID767

CABT-L3006-100uL500uL 100 uL, 500 uL
EUR 502.00

Monoclonal FOLH1 / PSMA Antibody (clone 3H5), Clone: 3H5

AMM04578G 0.05ml
EUR 484.00
Description: A Monoclonal antibody against Human FOLH1 / PSMA (clone 3H5). The antibodies are raised in Mouse and are from clone 3H5. This antibody is applicable in WB and IHC-P, IF, Flo

Monoclonal FOLH1 / PSMA Antibody (clone 5C4), Clone: 5C4

AMM04579G 0.05ml
EUR 484.00
Description: A Monoclonal antibody against Human FOLH1 / PSMA (clone 5C4). The antibodies are raised in Mouse and are from clone 5C4. This antibody is applicable in WB and IHC-P, Flo

PSMA Aptamer, unlabeled (A10.L), RNA Aptamer

AR-301-U Custom Ask for price

Recombinant Anti-CD3 x Anti-PSMA Bispecific Antibody (Tandem scFv)

BSFV-102-100ug 100μg
EUR 3560.00
Description: A bispecific antibody that is expressed as an anti-CD3 scFv fused with an anti-PSMA scFv, contains a His-tag at the C/N terminus for affinity purification. This BsAb can retarget T cells to tumor cells. It is designed for the research of Prostate cancer therapy.

Recombinant Anti-CD3 x Anti-PSMA Bispecific Antibody (Tandem scFv)

BSFV-102-50ug 50μg
EUR 2039.00
Description: A bispecific antibody that is expressed as an anti-CD3 scFv fused with an anti-PSMA scFv, contains a His-tag at the C/N terminus for affinity purification. This BsAb can retarget T cells to tumor cells. It is designed for the research of Prostate cancer therapy.

Monoclonal FOLH1 / PSMA Antibody (aa117-351, clone K1H7), Clone: K1H7

AMM04577G 0.05mg
EUR 484.00
Description: A Monoclonal antibody against Human FOLH1 / PSMA (aa117-351, clone K1H7). The antibodies are raised in Mouse and are from clone K1H7. This antibody is applicable in WB and IHC-P, E

Monoclonal FOLH1 / PSMA Antibody (clone Y-PSMA1), Clone: Y-PSMA1

AMM04580G 0.05mg
EUR 484.00
Description: A Monoclonal antibody against Human FOLH1 / PSMA (clone Y-PSMA1). The antibodies are raised in Mouse and are from clone Y-PSMA1. This antibody is applicable in WB and IHC-P, IF, E, IHC-Fr

Anti-PSMA (Prostate specific membrane antigen) Rabbit Monoclonal Antibody (RM327)

A1841-50
EUR 311.00

Human Prostate specific membrane antigen (PSMA) ELISA Kit

abx352263-96tests 96 tests
EUR 707.00
  • Shipped within 5-12 working days.

Human PSMA(Prostate specific membrane antigen)ELISA Kit

STJ150476 1 kit
EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of PSMA in human serum, plasma and other biological fluids

ELISA kit for Human PSMA (Prostate specific membrane antigen)

E-EL-H5413 1 plate of 96 wells
EUR 534.00
  • Gentaur's PSMA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PSMA. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PSMA (Prostate specific membrane antigen) in samples from Serum, Plasma, Cell supernatant

Human CellExp? PSMA / FOLH1, C-His Tag, human recombinant

P1304-100 Ask for price

Human CellExp? PSMA / FOLH1, C-His Tag, human recombinant

P1304-25
EUR 1300.00

Human CellExp? PSMA / FOLH1, C-His Tag, human recombinant

P1304-5
EUR 370.00

H2B Antibody Antibody

AF4659 200ul
EUR 376.00
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody

ABD2911 100 ug
EUR 438.00

anti- Antibody^Polyclonal antibody control antibody

LSMab09882 100 ug
EUR 438.00

Ly1 Antibody Reactive (LYAR) Antibody

20-abx008109
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

20-abx004855
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx123734
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx036399-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx014333
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319900
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319901
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319905
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319913
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx234901-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx324434
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx311665
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx230204-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277.00
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277.00
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277.00

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277.00

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277.00
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277.00

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277.00
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277.00

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277.00

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277.00

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277.00
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277.00

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277.00
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277.00
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277.00

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277.00

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277.00

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277.00

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277.00
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Cytokeratin 7 antibody-Cytoskeleton Marker Antibody

48169-100ul 100ul
EUR 333.00

Cytokeratin 7 antibody-Cytoskeleton Marker Antibody

48169-50ul 50ul
EUR 239.00

Antibody Pair to ApoA-V antibody

10R-1876 100 ul
EUR 651.00
Description: Mouse monoclonal Antibody Pair to ApoA-V antibody

Anti CD22 Antibody: CD22 Monoclonal Antibody

065-A-01mg 0,1 mg
EUR 267.50
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody

Anti CD22 Antibody: CD22 Monoclonal Antibody

065-A-1000ug 1000 ug
EUR 1282.50
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody

Hepatitis C Virus Antibody (HCV) Antibody

abx023924-1mg 1 mg
EUR 1205.00
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody

20-abx103034
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody

20-abx103035
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody

20-abx103036
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Monoclonal NGF/proNGF Neutralizing Antibody Antibody

AMM06679G 0.05mg
EUR 528.00
Description: A Monoclonal antibody against Human NGF/proNGF Neutralizing. The antibodies are raised in Mouse. This antibody is applicable in E

Anti Deoxyribonucleic Acid Antibody (DNA) Antibody

abx411057-50ug 50 ug
EUR 592.00
  • Shipped within 1 week.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)

20-abx319902
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)

20-abx319903
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)

20-abx319904
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)

20-abx319906
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)

20-abx319907
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)

20-abx319908
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)

20-abx319914
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)

20-abx319915
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)

20-abx319916
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)

20-abx319929
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)

20-abx319930
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)

20-abx319931
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein 210 Antibody (gp210) Antibody

abx233571-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Ly1 Antibody Reactive (LYAR) Antibody (HRP)

20-abx311666
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody (FITC)

20-abx311667
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody (Biotin)

20-abx311668
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Goat anti- human Antibody^Polyclonal antibody

LSMab09896 100 ug
EUR 438.00

Antibody for Human alpha Tubulin Antibody

SPC-692D 0.1mg
EUR 354.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is unconjugated.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A390 0.1mg
EUR 401.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 390.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A488 0.1mg
EUR 400.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 488.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A565 0.1mg
EUR 400.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 565.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A594 0.1mg
EUR 400.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 594.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A633 0.1mg
EUR 400.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 633.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A655 0.1mg
EUR 400.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 655.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A680 0.1mg
EUR 400.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 680.

Antibody for Human alpha Tubulin Antibody

SPC-692D-A700 0.1mg
EUR 400.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 700.

Antibody for Human alpha Tubulin Antibody

SPC-692D-ALP 0.1mg
EUR 394.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Alkaline Phosphatase.

Antibody for Human alpha Tubulin Antibody

SPC-692D-APC 0.1mg
EUR 399.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to APC .

Antibody for Human alpha Tubulin Antibody

SPC-692D-APCCY7 0.1mg
EUR 471.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to APC/Cy7.

Antibody for Human alpha Tubulin Antibody

SPC-692D-BI 0.1mg
EUR 396.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Biotin.

Antibody for Human alpha Tubulin Antibody

SPC-692D-DY350 0.1mg
EUR 414.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 350.

Antibody for Human alpha Tubulin Antibody

SPC-692D-DY405 0.1mg
EUR 403.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 405.

Antibody for Human alpha Tubulin Antibody

SPC-692D-DY488 0.1mg
EUR 393.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 488.

Antibody for Human alpha Tubulin Antibody

SPC-692D-DY594 0.1mg
EUR 395.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 594.

Antibody for Human alpha Tubulin Antibody

SPC-692D-DY633 0.1mg
EUR 390.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 633.

Antibody for Human alpha Tubulin Antibody

SPC-692D-FITC 0.1mg
EUR 392.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to FITC.

Antibody for Human alpha Tubulin Antibody

SPC-692D-HRP 0.1mg
EUR 388.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to HRP.

Antibody for Human alpha Tubulin Antibody

SPC-692D-P594 0.1mg
EUR 407.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to PE/ATTO 594.

Antibody for Human alpha Tubulin Antibody

SPC-692D-PCP 0.1mg
EUR 399.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to PerCP.

Antibody for Human alpha Tubulin Antibody

SPC-692D-RPE 0.1mg
EUR 397.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to RPE .

Antibody for Human alpha Tubulin Antibody

SPC-692D-STR 0.1mg
EUR 398.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Streptavidin.

Antibody for Human alpha Tubulin Antibody

SPC-692S 0.012mg
EUR 65.00
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is unconjugated.

Anti-IgG1 Negative Control Antibody antibody

STJ16100881 1 mL
EUR 478.00

Anti-Noelin Antibody BIOTIN Antibody BIOTIN

STJ501938 100 µg
EUR 586.00

Anti-Noelin Antibody FITC Antibody FITC

STJ501939 100 µg
EUR 586.00

Anti-Noelin Antibody BIOTIN Antibody BIOTIN

STJ501940 100 µg
EUR 586.00

Anti-Noelin Antibody FITC Antibody FITC

STJ501941 100 µg
EUR 586.00

Bad Antibody

3030-100
EUR 338.00

BAK1 Antibody

3031-100
EUR 316.00

BAK1 Antibody

3031-30T
EUR 146.00

Bax Antibody

3032-100
EUR 316.00

Bax Antibody

3032-30T
EUR 146.00

p53 Antibody

3036R-100
EUR 316.00

p53 Antibody

3036R-30T
EUR 146.00

RAIDD Antibody

3037-100
EUR 316.00

RAIDD Antibody

3037-30T
EUR 146.00

FADD Antibody

3039-100
EUR 349.00

FADD Antibody

3039-30T
EUR 146.00

Bok Antibody

3043-100
EUR 359.00

PBR Antibody

3044-100
EUR 376.00

PBR Antibody

3044-30T
EUR 146.00

TRAIL Antibody

3045-100
EUR 316.00

TRAIL Antibody

3045-30T
EUR 146.00

DFF45 Antibody

3048-100
EUR 338.00

DFF40 Antibody

3049-100
EUR 338.00

Leave a Reply

Your email address will not be published. Required fields are marked *