Acetylcholinesterase (AChE) polyclonal antibody from hybrid catfish (C. macrocephalus × C. gariepinus): Specification, sensitivity and cross reactivity
AChE (acetylcholinesterase) is mostly labeled as a particular biomarker of pesticide publicity. The purpose of this examine was to supply AChE polyclonal antibody from hybrid catfish that have been uncovered to industrial glyphosate. The hybrid catfish was uncovered to glyphosate (0.75 mL/L) for 24 h.
After that, the fish mind was dissected, AChE was extracted and purified by hydroxyapatite column chromatography and eluted with 0.2 M potassium phosphate buffer pH 6.8. This protocol gave 70% yield. Then, the mind extract was characterised utilizing 10% SDS-PAGE and Western blot probed with industrial polyclonal antibody particular to AChE (PAb-AChE). The protein, 71 kDa, was then used as an antigen to immunize mice for antibody manufacturing.
The polyclonal antibody (PAb) was characterised utilizing dot blot, Western blot and immunohistochemistry for immunolocalization of AChE in hybrid catfish uncovered to glyphosate. We discovered that the suitable dilution of antibody for each dot blot and Western blot was 1:3500, and 1:2500 for immunohistochemistry.
Cross reactivity testing confirmed that PAb-AChE can be utilized with AChE from striped snakehead fish on the similar dilution as used with AChE from hybrid catfish. It was concluded that PAb particular to hybrid catfish AChE from this work was extremely particular and delicate, and might cross-react with striped snakehead fish AChE. Thus, this polyclonal antibody could also be utilized in monitoring glyphosate publicity in hybrid catfish and striped snakehead fish.

i-dna
EIF2B1 antibody |
70R-3849 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal EIF2B1 antibody raised against the C terminal of EIF2B1 |
EIF2B1 antibody |
70R-17038 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal EIF2B1 antibody |
EIF2B1 Antibody |
DF12392 |
Affbiotech |
200ul |
EUR 304 |
Description: EIF2B1 antibody detects endogenous levels of EIF2B1. |
EIF2B1 Antibody |
1-CSB-PA007514GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF |
EIF2B1 Antibody |
1-CSB-PA623910ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
EIF2B1 Antibody |
1-CSB-PA623910ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
EIF2B1 Polyclonal Antibody |
31370-100ul |
SAB |
100ul |
EUR 252 |
EIF2B1 Polyclonal Antibody |
31370-50ul |
SAB |
50ul |
EUR 187 |
EIF2B1 siRNA |
20-abx901673 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EIF2B1 Protein |
20-abx263439 |
Abbexa |
-
EUR 230.00
-
EUR 1609.00
-
EUR 328.00
|
|
- Shipped within 5-10 working days.
|
EIF2B1 siRNA |
20-abx915139 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EIF2B1 siRNA |
20-abx915140 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EIF2B1 Polyclonal Conjugated Antibody |
C31370 |
SAB |
100ul |
EUR 397 |
EIF2B1 Rabbit pAb |
A7892-100ul |
Abclonal |
100 ul |
EUR 308 |
EIF2B1 Rabbit pAb |
A7892-200ul |
Abclonal |
200 ul |
EUR 459 |
EIF2B1 Rabbit pAb |
A7892-20ul |
Abclonal |
20 ul |
EUR 183 |
EIF2B1 Rabbit pAb |
A7892-50ul |
Abclonal |
50 ul |
EUR 223 |
EIF2B1 Blocking Peptide |
33R-1107 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACBD5 antibody, catalog no. 70R-6731 |
EIF2B1 Blocking Peptide |
DF12392-BP |
Affbiotech |
1mg |
EUR 195 |
EIF2B1 cloning plasmid |
CSB-CL623910HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 918
- Sequence: ATGGACGACAAGGAGTTAATTGAATACTTTAAGTCTCAGATGAAAGAAGATCCTGACATGGCCTCAGCAGTGGCTGCCATCCGGACGTTGCTGGAGTTCTTGAAGAGAGATAAAGGGGAGACAATCCAGGGTCTGAGGGCGAATCTCACCAGTGCCATAGAAACCCTGTGTGGTGT
- Show more
|
Description: A cloning plasmid for the EIF2B1 gene. |
Polyclonal Goat anti-GST α-form |
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST μ-form |
GST-ANTI-2 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST p-form |
GST-ANTI-3 |
Detroit R&D |
50 uL |
EUR 280 |
Mouse EIF2B1 shRNA Plasmid |
20-abx980609 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat EIF2B1 shRNA Plasmid |
20-abx986264 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human EIF2B1 shRNA Plasmid |
20-abx951361 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EIF2B1 protein (His tag) |
80R-1781 |
Fitzgerald |
10 ug |
EUR 305 |
Description: Purified recombinant Human EIF2B1 protein |
EIF2B1 Recombinant Protein (Human) |
RP038725 |
ABM |
100 ug |
Ask for price |
EIF2B1 Recombinant Protein (Rat) |
RP199301 |
ABM |
100 ug |
Ask for price |
EIF2B1 Recombinant Protein (Mouse) |
RP131213 |
ABM |
100 ug |
Ask for price |
Eif2b1 ORF Vector (Rat) (pORF) |
ORF066435 |
ABM |
1.0 ug DNA |
EUR 506 |
Eif2b1 ORF Vector (Mouse) (pORF) |
ORF043739 |
ABM |
1.0 ug DNA |
EUR 506 |
EIF2B1 ORF Vector (Human) (pORF) |
ORF012909 |
ABM |
1.0 ug DNA |
EUR 354 |
EIF2B1 sgRNA CRISPR Lentivector set (Human) |
K0665501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Eif2b1 sgRNA CRISPR Lentivector set (Mouse) |
K4892101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Eif2b1 sgRNA CRISPR Lentivector set (Rat) |
K7080801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody |
20-abx112365 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 2B Subunit Alpha (eIF2B1) Antibody |
20-abx142023 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody |
20-abx007084 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody |
20-abx320993 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody |
20-abx322477 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody |
abx232693-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0665502 |
ABM |
1.0 ug DNA |
EUR 154 |
EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0665503 |
ABM |
1.0 ug DNA |
EUR 154 |
EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0665504 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4892102 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4892103 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4892104 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7080802 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7080803 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7080804 |
ABM |
1.0 ug DNA |
EUR 154 |
EIF2B1 Protein Vector (Human) (pPB-C-His) |
PV051633 |
ABM |
500 ng |
EUR 481 |
EIF2B1 Protein Vector (Human) (pPB-N-His) |
PV051634 |
ABM |
500 ng |
EUR 481 |
EIF2B1 Protein Vector (Human) (pPM-C-HA) |
PV051635 |
ABM |
500 ng |
EUR 481 |
EIF2B1 Protein Vector (Human) (pPM-C-His) |
PV051636 |
ABM |
500 ng |
EUR 481 |
EIF2B1 Protein Vector (Mouse) (pPB-C-His) |
PV174954 |
ABM |
500 ng |
EUR 603 |
EIF2B1 Protein Vector (Mouse) (pPB-N-His) |
PV174955 |
ABM |
500 ng |
EUR 603 |
EIF2B1 Protein Vector (Mouse) (pPM-C-HA) |
PV174956 |
ABM |
500 ng |
EUR 603 |
EIF2B1 Protein Vector (Mouse) (pPM-C-His) |
PV174957 |
ABM |
500 ng |
EUR 603 |
Recombinant Human EIF2B1 Protein, GST, E.coli-100ug |
QP7612-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human EIF2B1 Protein, GST, E.coli-10ug |
QP7612-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human EIF2B1 Protein, GST, E.coli-1mg |
QP7612-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human EIF2B1 Protein, GST, E.coli-200ug |
QP7612-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human EIF2B1 Protein, GST, E.coli-500ug |
QP7612-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human EIF2B1 Protein, GST, E.coli-50ug |
QP7612-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
EIF2B1 Protein Vector (Rat) (pPB-C-His) |
PV265738 |
ABM |
500 ng |
EUR 603 |
EIF2B1 Protein Vector (Rat) (pPB-N-His) |
PV265739 |
ABM |
500 ng |
EUR 603 |
EIF2B1 Protein Vector (Rat) (pPM-C-HA) |
PV265740 |
ABM |
500 ng |
EUR 603 |
EIF2B1 Protein Vector (Rat) (pPM-C-His) |
PV265741 |
ABM |
500 ng |
EUR 603 |
Eif2b1 3'UTR Luciferase Stable Cell Line |
TU203867 |
ABM |
1.0 ml |
Ask for price |
Eif2b1 3'UTR GFP Stable Cell Line |
TU155699 |
ABM |
1.0 ml |
Ask for price |
EIF2B1 3'UTR Luciferase Stable Cell Line |
TU006709 |
ABM |
1.0 ml |
EUR 1394 |
Eif2b1 3'UTR Luciferase Stable Cell Line |
TU105699 |
ABM |
1.0 ml |
Ask for price |
EIF2B1 3'UTR GFP Stable Cell Line |
TU056709 |
ABM |
1.0 ml |
EUR 1394 |
Eif2b1 3'UTR GFP Stable Cell Line |
TU253867 |
ABM |
1.0 ml |
Ask for price |
EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV677041 |
ABM |
1.0 ug DNA |
EUR 514 |
EIF2B1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV677045 |
ABM |
1.0 ug DNA |
EUR 514 |
EIF2B1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV677046 |
ABM |
1.0 ug DNA |
EUR 514 |
EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV703599 |
ABM |
1.0 ug DNA |
EUR 450 |
EIF2B1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV703603 |
ABM |
1.0 ug DNA |
EUR 450 |
EIF2B1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV703604 |
ABM |
1.0 ug DNA |
EUR 450 |
Human Translation initiation factor eIF-2B subunit alpha (EIF2B1) |
1-CSB-EP623910HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 60.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Translation initiation factor eIF-2B subunit alpha(EIF2B1) expressed in E.coli |
EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K0665505 |
ABM |
3 x 1.0 ug |
EUR 376 |
Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
K4892105 |
ABM |
3 x 1.0 ug |
EUR 376 |
Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat) |
K7080805 |
ABM |
3 x 1.0 ug |
EUR 376 |
EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K0665506 |
ABM |
1.0 ug DNA |
EUR 167 |
EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K0665507 |
ABM |
1.0 ug DNA |
EUR 167 |
EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K0665508 |
ABM |
1.0 ug DNA |
EUR 167 |
Human Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) ELISA Kit |
abx387084-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1) |
K4892106 |
ABM |
1.0 ug DNA |
EUR 167 |
Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2) |
K4892107 |
ABM |
1.0 ug DNA |
EUR 167 |
Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3) |
K4892108 |
ABM |
1.0 ug DNA |
EUR 167 |
EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA) |
LV677042 |
ABM |
1.0 ug DNA |
EUR 514 |
EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
LV677043 |
ABM |
1.0 ug DNA |
EUR 572 |
EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
LV677044 |
ABM |
1.0 ug DNA |
EUR 572 |
EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA) |
LV703600 |
ABM |
1.0 ug DNA |
EUR 450 |
EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
LV703601 |
ABM |
1.0 ug DNA |
EUR 508 |
EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
LV703602 |
ABM |
1.0 ug DNA |
EUR 508 |
Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1) |
K7080806 |
ABM |
1.0 ug DNA |
EUR 167 |
Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2) |
K7080807 |
ABM |
1.0 ug DNA |
EUR 167 |
Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3) |
K7080808 |
ABM |
1.0 ug DNA |
EUR 167 |
EIF2B1 Eukaryotic Translation Initiation Factor 2B Subunit 1 Alpha Human Recombinant Protein |
PROTQ14232 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: EIF2B1 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 325 amino acids (1-305 a.a.) and having a molecular mass of 35.8kDa.;EIF2B1 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Era of Excessive Affinity Anti-Peptide Polyclonal Antibodies Recognizing Goat α s1-Casein
The chemical, technological and allergy properties of goat’s milk are considerably affected by the extent of αs1-casein. Detection and quantification of αs1-casein requires high-specificity strategies to beat high-sequence similarity between this protein and others within the casein household. Unavailability of antibodies with excessive affinity and specificity in direction of goat αs1-casein hinders the event of immuno-based analytical strategies comparable to enzyme-linked immunosorbent assay (ELISA) and biosensors.
Right here, we report the era of polyclonal antibodies (or immunoglobulins, IgGs) raised in direction of goat αs1-casein N- (Nter) and C-terminal (Cter) peptide sequences. The Nter and Cter peptides of goat αs1-casein have been immunized in rabbits for the era of antisera, which have been purified utilizing protein G affinity chromatography. The binding affinity of the antisera and purified IgGs have been examined and in contrast utilizing oblique ELISA, the place peptide-BSA conjugates and goat αs1-casein have been used because the coating antigens.
The Nter antiserum displayed greater titer than Cter antiserum, at 1/64,000 and 1/32,000 dilutions, respectively. The purification step additional yielded 0.5 mg/mL of purified IgGs from Three mL of antisera. The purified Nter IgG confirmed a considerably (p < 0.05) greater binding affinity in direction of peptide-BSA and goat αs1-casein, with decrease Okayd worth at 5.063 × 10-3 μM in comparison with 9.046 × 10-3 μM for the Cter IgG. A cross-reactivity take a look at confirmed that there was no binding in neither Nter nor Cter IgGs in direction of protein extracts from the milk of cow, buffalo, horse and camel. Excessive-quality antibodies generated will permit additional improvement of immuno-based analytical strategies and future in vitro research to be carried out on goat αs1-casein.
Expression of HPV16 E6 recombinant protein and preparation of its rabbit polyclonal antibody
Goal To specific E6 protein of human papillomavirus (HPV) sort 16 in prokaryotic expression system and put together its polyclonal antibody. Strategies HPV16 E6 gene was obtained from Siha cells by PCR and cloned into pET21a(+) vector to assemble the recombinant plasmid pET21a(+)/HPV16 E6 that was confirmed by sequencing. The recombinant plasmid pET21a(+)/HPV16 E6 was reworked into E. coli BL21 (DE3). The HPV16 E6-His tag recombinant protein was expressed after the induction of isopropyl beta-D-1-thiogalactopyranoside (IPTG), purified by Ni-NTA affinity chromatography, after which analyzed by Western blot evaluation. The purified HPV16 E6 recombinant protein was used to immunize Japanese white rabbits to organize polyclonal antibody.
The titer of the serum polyclonal antibody was decided by ELISA. The specificity of the polyclonal antibody was analyzed by Western blotting and immunofluorescence. Outcomes The recombinant plasmid pET21a(+)/HPV16 E6 was efficiently constructed and confirmed by sequencing.
After the recombinant plasmid pET21a(+)/HPV16 E6 was reworked into E. coli BL21 (DE3), the recombinant HPV16 E6 protein was expressed and purified by affinity chromatography. The polyclonal antibody at a titer of 1:40 000 was obtained by immunizing Japanese big-ear white rabbit with the purified recombinant HPV16 E6 protein, and its specificity was confirmed by Western blotting and immunofluorescence assay. Conclusion HPV16 E6 recombinant protein was efficiently expressed and the rabbit polyclonal antibody towards HPV16 E6 recombinant protein was ready.
Anti-PSMA Antibody |
A02846 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal PSMA Antibody. Validated in WB and tested in Human. |
PSMA Conjugated Antibody |
C21694 |
SAB |
100ul |
EUR 397 |
Anti-PSMA antibody |
STJ190089 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Mouse monoclonal to PSMA (2A2) |
anti-PSMA |
YF-PA23731 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PSMA |
Polyclonal FOLH1 / PSMA Antibody |
AMM04576G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FOLH1 / PSMA . This antibody is tested and proven to work in the following applications: |
anti- PSMA/GCPII antibody |
FNab06860 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: folate hydrolase(prostate-specific membrane antigen) 1
- Uniprot ID: Q04609
- Research Area: Cancer, Immunology, Cardiovascular, Metabolism
|
Description: Antibody raised against PSMA/GCPII |
Anti-PSMA Purified |
11-532-C025 |
ExBio |
0.025 mg |
EUR 126 |
Anti-PSMA Purified |
11-532-C100 |
ExBio |
0.1 mg |
EUR 213 |
Anti-PSMA Purified |
11-539-C025 |
ExBio |
0.025 mg |
EUR 126 |
Anti-PSMA Purified |
11-539-C100 |
ExBio |
0.1 mg |
EUR 213 |
Anti-PSMA PE |
1P-539-C025 |
ExBio |
0.025 mg |
EUR 190 |
Anti-PSMA PE |
1P-539-C100 |
ExBio |
0.1 mg |
EUR 340 |
Monoclonal PSMA Antibody, Clone: EP3254 |
AMR09576G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human PSMA. The antibodies are raised in Rabbit and are from clone EP3254. This antibody is applicable in WB and IF |
Monoclonal PSMA Antibody, Clone: EP3253 |
AMR09577G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human PSMA. The antibodies are raised in Rabbit and are from clone EP3253. This antibody is applicable in WB |
Anti-PSMA Rabbit Monoclonal Antibody |
M02846 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal PSMA Antibody. Validated in IP, IHC, WB and tested in Human. |
Anti-PSMA Alexa Fluor488 |
A4-539-C025 |
ExBio |
0.025 mg |
EUR 227 |
Anti-PSMA Alexa Fluor488 |
A4-539-C100 |
ExBio |
0.1 mg |
EUR 414 |
Prostate Specific Membrane Antigen (PSMA) Antibody |
abx414664-01mg |
Abbexa |
0.1 mg |
EUR 439 |
|
Anti-PSMA Rabbit Monoclonal Antibody, Clone#RM327 |
M02846-1 |
BosterBio |
100uL |
EUR 385 |
Description: Anti-PSMA Rabbit Monoclonal Antibody, Clone#RM327 tested in WB, IHC, reactive to Human |
Mouse Anti-Human PSMA monoclonal antibody, clone JID767 |
CABT-L3006-100uL500uL |
Creative Diagnostics |
100 uL, 500 uL |
EUR 502 |
Monoclonal FOLH1 / PSMA Antibody (clone 3H5), Clone: 3H5 |
AMM04578G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human FOLH1 / PSMA (clone 3H5). The antibodies are raised in Mouse and are from clone 3H5. This antibody is applicable in WB and IHC-P, IF, Flo |
Monoclonal FOLH1 / PSMA Antibody (clone 5C4), Clone: 5C4 |
AMM04579G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human FOLH1 / PSMA (clone 5C4). The antibodies are raised in Mouse and are from clone 5C4. This antibody is applicable in WB and IHC-P, Flo |
PSMA Aptamer, unlabeled (A10.L), RNA Aptamer |
AR-301-U |
Alpha Diagnostics |
Custom |
Ask for price |
Recombinant Anti-CD3 x Anti-PSMA Bispecific Antibody (Tandem scFv) |
BSFV-102-100ug |
Creative Biolabs |
100μg |
EUR 3560 |
Description: A bispecific antibody that is expressed as an anti-CD3 scFv fused with an anti-PSMA scFv, contains a His-tag at the C/N terminus for affinity purification. This BsAb can retarget T cells to tumor cells. It is designed for the research of Prostate cancer therapy. |
Recombinant Anti-CD3 x Anti-PSMA Bispecific Antibody (Tandem scFv) |
BSFV-102-50ug |
Creative Biolabs |
50μg |
EUR 2039 |
Description: A bispecific antibody that is expressed as an anti-CD3 scFv fused with an anti-PSMA scFv, contains a His-tag at the C/N terminus for affinity purification. This BsAb can retarget T cells to tumor cells. It is designed for the research of Prostate cancer therapy. |
Monoclonal FOLH1 / PSMA Antibody (aa117-351, clone K1H7), Clone: K1H7 |
AMM04577G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human FOLH1 / PSMA (aa117-351, clone K1H7). The antibodies are raised in Mouse and are from clone K1H7. This antibody is applicable in WB and IHC-P, E |
Monoclonal FOLH1 / PSMA Antibody (clone Y-PSMA1), Clone: Y-PSMA1 |
AMM04580G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human FOLH1 / PSMA (clone Y-PSMA1). The antibodies are raised in Mouse and are from clone Y-PSMA1. This antibody is applicable in WB and IHC-P, IF, E, IHC-Fr |
Anti-PSMA (Prostate specific membrane antigen) Rabbit Monoclonal Antibody (RM327) |
A1841-50 |
Biovision |
|
EUR 311 |
Human Prostate specific membrane antigen (PSMA) ELISA Kit |
abx352263-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human PSMA(Prostate specific membrane antigen)ELISA Kit |
STJ150476 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of PSMA in human serum, plasma and other biological fluids |
ELISA kit for Human PSMA (Prostate specific membrane antigen) |
E-EL-H5413 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's PSMA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PSMA. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human PSMA (Prostate specific membrane antigen) in samples from Serum, Plasma, Cell supernatant |
Human CellExp? PSMA / FOLH1, C-His Tag, human recombinant |
P1304-100 |
Biovision |
|
Ask for price |
Human CellExp? PSMA / FOLH1, C-His Tag, human recombinant |
P1304-25 |
Biovision |
|
EUR 1300 |
Human CellExp? PSMA / FOLH1, C-His Tag, human recombinant |
P1304-5 |
Biovision |
|
EUR 370 |
H2B Antibody Antibody |
AF4659 |
Affbiotech |
200ul |
EUR 376 |
Description: H2B Antibody Antibody detects endogenous levels of H2B. |
anti- Antibody^Polyclonal antibody control antibody |
LSMab09882 |
Lifescience Market |
100 ug |
EUR 438 |
Ly1 Antibody Reactive (LYAR) Antibody |
20-abx008109 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Anti-Glycolipid Antibody (AGA) Antibody |
20-abx004855 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
20-abx123734 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-Glycolipid Antibody (AGA) Antibody |
abx036399-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
20-abx014333 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
abx033330-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
abx033330-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody |
20-abx319900 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody |
20-abx319901 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody |
20-abx319905 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody |
20-abx319913 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
abx234901-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
20-abx324434 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
20-abx311665 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycolipid Antibody (AGA) Antibody |
abx230204-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Anti-Anti-SEPT6 antibody antibody |
STJ11100949 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined. |
Anti-Anti-SEPT9 Antibody antibody |
STJ111369 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described. |
Anti-Anti-SEPT4 Antibody antibody |
STJ112276 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. |
Anti-Anti-SEPT5 Antibody antibody |
STJ25477 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced. |
Anti-Anti-SEPT8 Antibody antibody |
STJ25479 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-Anti-SEPT7 Antibody antibody |
STJ28963 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. |
Anti-Anti-SEPT5 Antibody antibody |
STJ114819 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced. |
Anti-Anti-SEPT7 Antibody antibody |
STJ116214 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. |
Anti-Anti-SEPT8 Antibody antibody |
STJ117206 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-Anti-SEPT12 Antibody antibody |
STJ117759 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-Anti-SEPT1 antibody antibody |
STJ119580 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012] |
Cytokeratin 7 antibody-Cytoskeleton Marker Antibody |
48169-100ul |
SAB |
100ul |
EUR 333 |
Cytokeratin 7 antibody-Cytoskeleton Marker Antibody |
48169-50ul |
SAB |
50ul |
EUR 239 |
Antibody Pair to ApoA-V antibody |
10R-1876 |
Fitzgerald |
100 ul |
EUR 651 |
Description: Mouse monoclonal Antibody Pair to ApoA-V antibody |
Anti CD22 Antibody: CD22 Monoclonal Antibody |
065-A-01mg |
Virogen |
0,1 mg |
EUR 267.5 |
- Category: Antibody, Signal Transduction Antibodies, mAb
|
Description: anti-CD22 monoclonal antibody |
Anti CD22 Antibody: CD22 Monoclonal Antibody |
065-A-1000ug |
Virogen |
1000 ug |
EUR 1282.5 |
- Category: Antibody, Signal Transduction Antibodies, mAb
|
Description: anti-CD22 monoclonal antibody |
Hepatitis C Virus Antibody (HCV) Antibody |
abx023924-1mg |
Abbexa |
1 mg |
EUR 1205 |
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive Homolog (LYAR) Antibody |
20-abx103034 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Ly1 Antibody Reactive Homolog (LYAR) Antibody |
20-abx103035 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Ly1 Antibody Reactive Homolog (LYAR) Antibody |
20-abx103036 |
Abbexa |
-
EUR 481.00
-
EUR 133.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Monoclonal NGF/proNGF Neutralizing Antibody Antibody |
AMM06679G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human NGF/proNGF Neutralizing. The antibodies are raised in Mouse. This antibody is applicable in E |
Anti Deoxyribonucleic Acid Antibody (DNA) Antibody |
abx411057-50ug |
Abbexa |
50 ug |
EUR 592 |
|
Anti-Glycoprotein Antibody (GP) Antibody (HRP) |
20-abx319902 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody (FITC) |
20-abx319903 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody (Biotin) |
20-abx319904 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody (HRP) |
20-abx319906 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody (FITC) |
20-abx319907 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody (Biotin) |
20-abx319908 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody (HRP) |
20-abx319914 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody (FITC) |
20-abx319915 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody (Biotin) |
20-abx319916 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody (HRP) |
20-abx319929 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody (FITC) |
20-abx319930 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody (Biotin) |
20-abx319931 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein 210 Antibody (gp210) Antibody |
abx233571-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody (HRP) |
20-abx311666 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody (FITC) |
20-abx311667 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody (Biotin) |
20-abx311668 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Goat anti- human Antibody^Polyclonal antibody |
LSMab09896 |
Lifescience Market |
100 ug |
EUR 438 |
Antibody for Human alpha Tubulin Antibody |
SPC-692D |
Stressmarq |
0.1mg |
EUR 354 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is unconjugated. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-A390 |
Stressmarq |
0.1mg |
EUR 401 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 390. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-A488 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 488. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-A565 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 565. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-A594 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 594. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-A633 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 633. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-A655 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 655. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-A680 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 680. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-A700 |
Stressmarq |
0.1mg |
EUR 400 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to ATTO 700. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-ALP |
Stressmarq |
0.1mg |
EUR 394 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-APC |
Stressmarq |
0.1mg |
EUR 399 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to APC . |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-APCCY7 |
Stressmarq |
0.1mg |
EUR 471 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to APC/Cy7. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-BI |
Stressmarq |
0.1mg |
EUR 396 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Biotin. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-DY350 |
Stressmarq |
0.1mg |
EUR 414 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 350. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-DY405 |
Stressmarq |
0.1mg |
EUR 403 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 405. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-DY488 |
Stressmarq |
0.1mg |
EUR 393 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 488. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-DY594 |
Stressmarq |
0.1mg |
EUR 395 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 594. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-DY633 |
Stressmarq |
0.1mg |
EUR 390 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Dylight 633. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-FITC |
Stressmarq |
0.1mg |
EUR 392 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to FITC. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-HRP |
Stressmarq |
0.1mg |
EUR 388 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to HRP. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-P594 |
Stressmarq |
0.1mg |
EUR 407 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to PE/ATTO 594. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-PCP |
Stressmarq |
0.1mg |
EUR 399 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to PerCP. |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-RPE |
Stressmarq |
0.1mg |
EUR 397 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to RPE . |
Antibody for Human alpha Tubulin Antibody |
SPC-692D-STR |
Stressmarq |
0.1mg |
EUR 398 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is conjugated to Streptavidin. |
Antibody for Human alpha Tubulin Antibody |
SPC-692S |
Stressmarq |
0.012mg |
EUR 65 |
Description: A polyclonal antibody for alpha Tubulin from Human. The antibody is produced in rabbit after immunization with human synthetic peptide of Human alpha-Tubulin. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This alpha Tubulin antibody is unconjugated. |