Goat Polyclonal Antibody Against the Sex Determining Region Y to Separate X- and Y-Chromosome

Goat Polyclonal Antibody In opposition to the Intercourse Figuring out Area Y to Separate X- and Y-Chromosome Bearing Spermatozoa.

 

Intercourse choice of sperm by separating X- and Y-chromosome bearing spermatozoa is vital for effectively acquiring the specified intercourse of animal offspring within the livestock trade. The aim of this examine was to provide a goat polyclonal antibody (pAb) towards the bovine Intercourse Figuring out Area Y chromosome (bSRY) to separate female- and male-bearing spermatozoa. To supply a goat polyclonal antibody towards bSRY, a feminine goat was subcutaneously immunized with 27 kDa of recombinant bSRY (rbSRY) protein because the antigen.

The anti-bSRY pAb was purified by ion-exchange chromatography. The purity of the pAb was decided utilizing the SDS-PAGE methodology. The organic exercise of the anti-bSRY pAb was examined utilizing PCR to evaluate the binding affinity of pAb for the bSRY antigen and commercially sexed bull sperm.

 

The whole quantity of purified anti-bSRY pAb was roughly 650 mg/goat serum (13 mg/mL). Curiously, our knowledge confirmed that the binding affinity of our pAb to the Y bearing was excessive, whereas the binding affinity of that to the X-chromosome bearing sperm was much like the detrimental management. In conclusion, our findings present that the goat anti-SRY pAb particularly binds to Y-chromosome bearing sperm that suggesting its potential use for intercourse choice.

 

 

Human Cholesterol-25-Hydroxylase (CH25H) ELISA Kit
RDR-CH25H-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Cholesterol-25-Hydroxylase (CH25H) ELISA Kit
RDR-CH25H-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Cholesterol-25-Hydroxylase (CH25H) ELISA Kit
RD-CH25H-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Cholesterol-25-Hydroxylase (CH25H) ELISA Kit
RD-CH25H-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

Anti-CH25H (1G8)
YF-MA16625	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CH25H

CH25H Antibody
1-CSB-PA005307LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CH25H. Recognizes CH25H from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Ch25h/ Rat Ch25h ELISA Kit
ELI-33482r	Lifescience Market	96 Tests	EUR 886

CH25H siRNA
20-abx901026	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CH25H siRNA
20-abx911626	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CH25H siRNA
20-abx911627	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CH25H Antibody, HRP conjugated
1-CSB-PA005307LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CH25H. Recognizes CH25H from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CH25H Antibody, FITC conjugated
1-CSB-PA005307LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CH25H. Recognizes CH25H from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CH25H Antibody, Biotin conjugated
1-CSB-PA005307LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CH25H. Recognizes CH25H from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

CH25H cloning plasmid
CSB-CL005307HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 819 Sequence: atgagctgccacaactgctccgacccccaggtcctttgcagctccgggcagctgttcctgcagcccctctgggaccacctgaggagctgggaggccctcctacagtcgcccttcttcccggtcatcttctccatcaccacatacgtgggcttttgcctgcccttcgtggtcctgga Show more
Description: A cloning plasmid for the CH25H gene.

CH25H cloning plasmid
CSB-CL005307HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 819 Sequence: atgagctgccacaactgctccgacccccaggtcctttgcagctccgggcagctcttcctgcagcccctctgggaccacctgaggagctgggaggccctcctacagtcgcccttcttcccggtcatcttctccatcaccacatacgtgggcttttgcctgcccttcgtggtcctgga Show more
Description: A cloning plasmid for the CH25H gene.

Cholesterol-25-Hydroxylase (CH25H) Antibody
20-abx175842	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Cholesterol-25-Hydroxylase (CH25H) Antibody
20-abx171719	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Cholesterol 25-Hydroxylase (CH25H) Antibody
20-abx301867	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Cholesterol 25-Hydroxylase (CH25H) Antibody (HRP)
20-abx316818	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Cholesterol 25-Hydroxylase (CH25H) Antibody (FITC)
20-abx316819	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Cholesterol 25-Hydroxylase (CH25H) Antibody (Biotin)
20-abx316820	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

CH25H ELISA KIT|Human
EF004749	Lifescience Market	96 Tests	EUR 689

Rat CH25H shRNA Plasmid
20-abx989559	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CH25H shRNA Plasmid
20-abx955950	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CH25H shRNA Plasmid
20-abx969657	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CH25H Recombinant Protein (Human)
RP006922	ABM	100 ug	Ask for price

CH25H Recombinant Protein (Human)
RP006925	ABM	100 ug	Ask for price

CH25H Recombinant Protein (Rat)
RP194753	ABM	100 ug	Ask for price

CH25H Recombinant Protein (Mouse)
RP123782	ABM	100 ug	Ask for price

Ch25h ORF Vector (Rat) (pORF)
ORF064919	ABM	1.0 ug DNA	EUR 506

CH25H ORF Vector (Human) (pORF)
ORF002308	ABM	1.0 ug DNA	EUR 95

CH25H ORF Vector (Human) (pORF)
ORF002309	ABM	1.0 ug DNA	EUR 95

Ch25h ORF Vector (Mouse) (pORF)
ORF041262	ABM	1.0 ug DNA	EUR 506

Recombinant Cholesterol-25-Hydroxylase (CH25H)
4-RPG357Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O95992 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Cholesterol-25-Hydroxylase expressed in: E.coli

Human Cholesterol-25-Hydroxylase (CH25H) Protein
20-abx652239	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CH25H sgRNA CRISPR Lentivector set (Human)
K0440801	ABM	3 x 1.0 ug	EUR 339

Ch25h sgRNA CRISPR Lentivector set (Rat)
K6262301	ABM	3 x 1.0 ug	EUR 339

Ch25h sgRNA CRISPR Lentivector set (Mouse)
K3647201	ABM	3 x 1.0 ug	EUR 339

Rat Cholesterol 25 hydroxylase(CH25H) ELISA kit
E02C1649-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cholesterol 25 hydroxylase(CH25H) ELISA kit
E02C1649-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cholesterol 25 hydroxylase(CH25H) ELISA kit
E02C1649-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cholesterol 25 hydroxylase(CH25H) ELISA kit
E03C1649-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cholesterol 25 hydroxylase(CH25H) ELISA kit
E03C1649-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cholesterol 25 hydroxylase(CH25H) ELISA kit
E03C1649-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cholesterol 25 hydroxylase(CH25H) ELISA kit
E06C1649-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cholesterol 25 hydroxylase(CH25H) ELISA kit
E06C1649-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cholesterol 25 hydroxylase(CH25H) ELISA kit
E06C1649-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cholesterol 25 hydroxylase(CH25H) ELISA kit
E04C1649-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cholesterol 25 hydroxylase(CH25H) ELISA kit
E04C1649-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cholesterol 25 hydroxylase(CH25H) ELISA kit
E04C1649-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cholesterol 25 hydroxylase(CH25H) ELISA kit
E01C1649-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cholesterol 25 hydroxylase(CH25H) ELISA kit
E01C1649-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cholesterol 25 hydroxylase(CH25H) ELISA kit
E01C1649-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cholesterol 25 hydroxylase(CH25H) ELISA kit
E07C1649-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cholesterol 25 hydroxylase(CH25H) ELISA kit
E07C1649-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cholesterol 25 hydroxylase(CH25H) ELISA kit
E07C1649-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cholesterol-25-Hydroxylase (CH25H) ELISA Kit
20-abx151048	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Cholesterol-25-Hydroxylase (CH25H) ELISA Kit
20-abx258600	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Monkey Cholesterol 25 hydroxylase(CH25H) ELISA kit
E09C1649-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cholesterol 25 hydroxylase(CH25H) ELISA kit
E09C1649-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cholesterol 25 hydroxylase(CH25H) ELISA kit
E09C1649-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cholesterol 25 hydroxylase(CH25H) ELISA kit
E08C1649-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cholesterol 25 hydroxylase(CH25H) ELISA kit
E08C1649-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cholesterol 25 hydroxylase(CH25H) ELISA kit
E08C1649-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CH25H/ Cholesterol 25-hydroxylase ELISA Kit
E2891Hu	Sunlong	1 Kit	EUR 605

Mouse Cholesterol 25- hydroxylase, Ch25h ELISA KIT
ELI-25459m	Lifescience Market	96 Tests	EUR 865

Rat Cholesterol 25-hydroxylase (CH25H) ELISA Kit
abx391120-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Cholesterol-25-Hydroxylase (CH25H) CLIA Kit
20-abx495171	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Cholesterol-25-Hydroxylase (CH25H) CLIA Kit
20-abx495172	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Cholesterol 25- hydroxylase, CH25H ELISA KIT
ELI-34078h	Lifescience Market	96 Tests	EUR 824

Porcine Cholesterol 25- hydroxylase, CH25H ELISA KIT
ELI-50769p	Lifescience Market	96 Tests	EUR 928

CH25H sgRNA CRISPR Lentivector (Human) (Target 1)
K0440802	ABM	1.0 ug DNA	EUR 154

 

Murine cross-reactive non-neutralizing polyclonal IgG1 antibodies induced by influenza vaccine inhibit the cross-protective impact of IgG2 towards heterologous virus in mice.

 

Annual vaccination towards influenza viruses is essentially the most dependable and environment friendly method to forestall and management annual epidemics and defend from extreme influenza illness. Nevertheless, present cut up influenza vaccines are usually not efficient towards antigenically mismatched (heterologous) strains. To broaden the protecting spectrum of influenza vaccines, adjuvants that may induce cross-reactive antibodies with cross-protection through Fc-mediated effector capabilities are urgently sought.

Though IgG2 antibodies are usually extra environment friendly than IgG1 antibodies in Fc-mediated effector capabilities, it isn’t but clear which IgG isotypes present superior cross-protection towards heterologous strains. It additionally stays unclear whether or not these IgG isotypes intervene with one another’s protecting results. Right here, we discovered that influenza cut up vaccine adjuvanted with aluminum salts, which predominantly induce cross-reactive IgG1, didn’t confer cross-protection towards heterologous virus problem in mice.

In distinction, cut up vaccine adjuvanted with CpG oligodeoxynucleotides, which predominantly induce cross-reactive IgG2, confirmed cross-protection by means of the interplay of cross-reactive non-neutralizing IgG2 and alveolar macrophages, indicating the significance of cross-reactive non-neutralizing IgG2 for cross-protection.

Moreover, through the use of serum samples from immunized mice and remoted polyclonal antibodies, we present that vaccine-induced cross-reactive non-neutralizing IgG1 suppress the cross-protective results of IgG2 by competitively inhibiting the binding of IgG2 to virus.

Thus, we display the brand new idea that cross-reactive IgG1 could intervene with the potential for cross-protection of influenza vaccine. We suggest that adjuvants that selectively induce virus-specific IgG2 in mice, reminiscent of CpG oligodeoxynucleotides, are optimum for heterologous safety.

Significance Present influenza vaccines are usually efficient towards extremely related virus strains by inducing neutralizing antibodies.

Nevertheless, these antibodies fail to neutralize antigenically mismatched (heterologous) strains and due to this fact present restricted safety towards them. Efforts are being made to develop vaccines with cross-protective means that will defend broadly towards heterologous strains, as a result of the mismatch between predicted and epidemic strains can’t all the time be averted, leading to low vaccine efficacy.

Right here we present that non-neutralizing IgG2 antibodies induced by an optimum adjuvant play a vital position in cross-protection towards heterologous virus problem in mice. Moreover, non-neutralizing polyclonal IgG1 suppressed the cross-protective results of non-neutralizing polyclonal IgG2 by competitively blocking the binding of IgG2 to its antigen.

These knowledge shed new mild on the significance of IgG isotypes and the choice of applicable adjuvants for the event of common influenza vaccines. Moreover, our findings are relevant to the rational design of vaccines towards different pathogens.

 

Sulfhydrylated graphene-encapsulated iron nanoparticles straight aminated with polyethylenimine: a novel magnetic nanoplatform for bioconjugation of gamma globulins and polyclonal antibodies.

 

This examine presents for the primary time the direct amination of graphene-encapsulated iron nanoparticles (GEINs) with polyethylenimine (PEI) through radical-type response. This work describes the primary instance of a direct addition of N-centered radical species onto the graphene layer.

The pristine PEI and the PEI hooked up to GEINs have additionally been derivatized to introduce sulfhydryl functionalities. The proposed two-step protocol constitutes a novel, versatile and low value methodology for the synthesis of polymer derivatives embellished with SH moieties.

The derivatives of pristine polyethylenimine have been analyzed via spectroscopic strategies (NMR and IR), whereas the obtained carbon supplies have been studied by thermogravimetry, infrared spectroscopy, dynamic mild scattering, and transmission electron microscopy.

Lastly, the concomitant a part of this work centered on the bioconjugation sort reactions of assorted biocompounds, together with bovine gamma-globulins and human polyclonal antibodies of sophistication IgG, with the as-obtained sulfhydrylated GEINs-PEI nanoplatform. The presence of immobilized molecules was confirmed by thermogravimetry, protein and fluorescence assays in addition to confocal microscopy pictures.

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit
DLR-NET1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuroepithelial Cell Transforming Gene 1 (NET1) in samples from tissue homogenates or other biological fluids.

Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit
DLR-NET1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuroepithelial Cell Transforming Gene 1 (NET1) in samples from tissue homogenates or other biological fluids.

Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit
RD-NET1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit
RD-NET1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit
RDR-NET1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit
RDR-NET1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Anti-NET1 / ARHGEF8 (Internal) antibody
STJ70935	St John's Laboratory	100 µg	EUR 359

NET1 antibody
70R-3139	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal NET1 antibody raised against the N terminal of NET1

NET1 antibody
70R-3140	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal NET1 antibody raised against the middle region of NET1

NET1 Antibody
ABD6345	Lifescience Market	100 ug	EUR 438

NET1 antibody
38218-100ul	SAB	100ul	EUR 252

NET1 antibody
10R-1416	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal NET1 antibody

NET1 antibody
70R-18846	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NET1 antibody

NET1 antibody
70R-10628	Fitzgerald	1 ml	EUR 693
Description: Affinity purified Chicken polyclonal NET1 antibody

NET1 Antibody
DF6345	Affbiotech	200ul	EUR 304
Description: NET1 Antibody detects endogenous levels of total NET1.

NET1 Antibody
1-CSB-PA768775LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

NET1 Antibody
1-CSB-PA015714GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

NET1 Antibody
CSB-PA015714KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

NET1 Antibody
CSB-PA015714KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

Anti-NET1 / ARHGEF8 (C Terminus) antibody
STJ70453	St John's Laboratory	100 µg	EUR 359

NET1 Conjugated Antibody
C38218	SAB	100ul	EUR 397

NET1 Polyclonal Antibody
A55443	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Polyclonal Goat Anti-NET1 / ARHGEF8 (Internal) Antibody
APG00217G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-NET1 / ARHGEF8 (Internal) . This antibody is tested and proven to work in the following applications:

NET1 siRNA
20-abx925749	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NET1 siRNA
20-abx925750	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Polyclonal NET1 Antibody (Internal)
APR02019G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NET1 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal NET1 Antibody (Internal)
APG01002G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NET1 (Internal). This antibody is tested and proven to work in the following applications:

NET1 Antibody, HRP conjugated
1-CSB-PA768775LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NET1 Antibody, FITC conjugated
1-CSB-PA768775LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NET1 Antibody, Biotin conjugated
1-CSB-PA768775LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal Goat Anti-NET1 / ARHGEF8 (C Terminus) Antibody
APG00216G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-NET1 / ARHGEF8 (C Terminus) . This antibody is tested and proven to work in the following applications:

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

NET1 Rabbit pAb
A1213-100ul	Abclonal	100 ul	EUR 308

NET1 Rabbit pAb
A1213-200ul	Abclonal	200 ul	EUR 459

NET1 Rabbit pAb
A1213-20ul	Abclonal	20 ul	EUR 183

NET1 Rabbit pAb
A1213-50ul	Abclonal	50 ul	EUR 223

NET1 Blocking Peptide
33R-1273	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NQO1 antibody, catalog no. 70R-10257

NET1 Blocking Peptide
33R-7919	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NET1 antibody, catalog no. 70R-3139

NET1 Blocking Peptide
DF6345-BP	Affbiotech	1mg	EUR 195

NET1 cloning plasmid
CSB-CL768775HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1629 Sequence: atggtggcacatgatgagactggaggtctcctacctattaaaaggaccatacgagtcctagatgtcaataaccagtccttcagagaacaagaggagccaagcaataaaagagttcgacctctggctcgtgtcacgtccttggcaaatttaatctctcctgtaagaaatggagctg Show more
Description: A cloning plasmid for the NET1 gene.

NET1 cloning plasmid
CSB-CL768775HU2-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1791 Sequence: atggagcccgagctggcggctcagaagcagcctcgaccgcggaggcgaagccgccgggcctctgggctcagcacggagggagcgacggggccttcggccgacacctccgggtcggagctggacgggagatgttcccttcggagaggcagctccttcacattcttaacacctggcc Show more
Description: A cloning plasmid for the NET1 gene.

pCMV-SPORT6-NET1
PVT13853	Lifescience Market	2 ug	EUR 391

Polyclonal NET1 Antibody (C-Terminus)
APR02020G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NET1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal NET1 Antibody (C-Terminus)
APG01001G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NET1 (C-Terminus). This antibody is tested and proven to work in the following applications:

NET1 Polyclonal Antibody, HRP Conjugated
A55444	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

NET1 Polyclonal Antibody, FITC Conjugated
A55445	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

NET1 Polyclonal Antibody, Biotin Conjugated
A55446	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Mouse NET1 shRNA Plasmid
20-abx974710	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NET1 ELISA KIT
ELI-11655h	Lifescience Market	96 Tests	EUR 824

NET1 ELISA KIT|Human
EF001180	Lifescience Market	96 Tests	EUR 689

Mouse Net1 ELISA KIT
ELI-34227m	Lifescience Market	96 Tests	EUR 865

Human NET1 shRNA Plasmid
20-abx956957	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NET1 Recombinant Protein (Human)
RP021076	ABM	100 ug	Ask for price

NET1 Recombinant Protein (Human)
RP021079	ABM	100 ug	Ask for price

NET1 Recombinant Protein (Rat)
RP213701	ABM	100 ug	Ask for price

NET1 Recombinant Protein (Mouse)
RP153716	ABM	100 ug	Ask for price

NET1 Recombinant Protein (Mouse)
RP153719	ABM	100 ug	Ask for price

Neuroepithelial Cell Transforming Gene 1 (NET1) Antibody
abx117067-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Neuroepithelial Cell Transforming Gene 1 (NET1) Antibody
20-abx001125	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Neuroepithelial Cell Transforming Gene 1 (NET1) Antibody
abx029492-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Neuroepithelial Cell Transforming Gene 1 (NET1) Antibody
abx029492-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Neuroepithelial Cell Transforming Gene 1 (NET1) Antibody
20-abx173761	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.