Goat Polyclonal Antibody In opposition to the Intercourse Figuring out Area Y to Separate X- and Y-Chromosome Bearing Spermatozoa.
Intercourse choice of sperm by separating X- and Y-chromosome bearing spermatozoa is vital for effectively acquiring the specified intercourse of animal offspring within the livestock trade. The aim of this examine was to provide a goat polyclonal antibody (pAb) towards the bovine Intercourse Figuring out Area Y chromosome (bSRY) to separate female- and male-bearing spermatozoa. To supply a goat polyclonal antibody towards bSRY, a feminine goat was subcutaneously immunized with 27 kDa of recombinant bSRY (rbSRY) protein because the antigen.
The anti-bSRY pAb was purified by ion-exchange chromatography. The purity of the pAb was decided utilizing the SDS-PAGE methodology. The organic exercise of the anti-bSRY pAb was examined utilizing PCR to evaluate the binding affinity of pAb for the bSRY antigen and commercially sexed bull sperm.
The whole quantity of purified anti-bSRY pAb was roughly 650 mg/goat serum (13 mg/mL). Curiously, our knowledge confirmed that the binding affinity of our pAb to the Y bearing was excessive, whereas the binding affinity of that to the X-chromosome bearing sperm was much like the detrimental management. In conclusion, our findings present that the goat anti-SRY pAb particularly binds to Y-chromosome bearing sperm that suggesting its potential use for intercourse choice.

i-dna
Human Cholesterol-25-Hydroxylase (CH25H) ELISA Kit |
RD-CH25H-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Cholesterol-25-Hydroxylase (CH25H) ELISA Kit |
RD-CH25H-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Cholesterol-25-Hydroxylase (CH25H) ELISA Kit |
RDR-CH25H-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Cholesterol-25-Hydroxylase (CH25H) ELISA Kit |
RDR-CH25H-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rabbit Polyclonal antibody Anti-CRBN |
Anti-CRBN |
ImmunoStep |
50 µg |
EUR 349 |
Anti-CH25H (1G8) |
YF-MA16625 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to CH25H |
CH25H Antibody |
1-CSB-PA005307LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CH25H. Recognizes CH25H from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
CH25H siRNA |
20-abx901026 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CH25H siRNA |
20-abx911626 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CH25H siRNA |
20-abx911627 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CH25H Antibody, HRP conjugated |
1-CSB-PA005307LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CH25H. Recognizes CH25H from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CH25H Antibody, FITC conjugated |
1-CSB-PA005307LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CH25H. Recognizes CH25H from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CH25H Antibody, Biotin conjugated |
1-CSB-PA005307LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CH25H. Recognizes CH25H from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Polyclonal Goat anti-GST α-form |
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST μ-form |
GST-ANTI-2 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST p-form |
GST-ANTI-3 |
Detroit R&D |
50 uL |
EUR 280 |
CH25H cloning plasmid |
CSB-CL005307HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 819
- Sequence: atgagctgccacaactgctccgacccccaggtcctttgcagctccgggcagctgttcctgcagcccctctgggaccacctgaggagctgggaggccctcctacagtcgcccttcttcccggtcatcttctccatcaccacatacgtgggcttttgcctgcccttcgtggtcctgga
- Show more
|
Description: A cloning plasmid for the CH25H gene. |
CH25H cloning plasmid |
CSB-CL005307HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 819
- Sequence: atgagctgccacaactgctccgacccccaggtcctttgcagctccgggcagctcttcctgcagcccctctgggaccacctgaggagctgggaggccctcctacagtcgcccttcttcccggtcatcttctccatcaccacatacgtgggcttttgcctgcccttcgtggtcctgga
- Show more
|
Description: A cloning plasmid for the CH25H gene. |
Cholesterol-25-Hydroxylase (CH25H) Antibody |
20-abx175842 |
Abbexa |
|
|
|
Cholesterol 25-Hydroxylase (CH25H) Antibody |
20-abx301867 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cholesterol-25-Hydroxylase (CH25H) Antibody |
20-abx171719 |
Abbexa |
|
|
|
Cholesterol 25-Hydroxylase (CH25H) Antibody (HRP) |
20-abx316818 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cholesterol 25-Hydroxylase (CH25H) Antibody (FITC) |
20-abx316819 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cholesterol 25-Hydroxylase (CH25H) Antibody (Biotin) |
20-abx316820 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rat CH25H shRNA Plasmid |
20-abx989559 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CH25H shRNA Plasmid |
20-abx955950 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CH25H shRNA Plasmid |
20-abx969657 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CH25H Recombinant Protein (Human) |
RP006922 |
ABM |
100 ug |
Ask for price |
CH25H Recombinant Protein (Human) |
RP006925 |
ABM |
100 ug |
Ask for price |
CH25H Recombinant Protein (Rat) |
RP194753 |
ABM |
100 ug |
Ask for price |
CH25H Recombinant Protein (Mouse) |
RP123782 |
ABM |
100 ug |
Ask for price |
CH25H (Human) ELISA Kit |
E4814-100 |
Biovision |
96 assay |
EUR 784 |
CH25H ORF Vector (Human) (pORF) |
ORF002308 |
ABM |
1.0 ug DNA |
EUR 95 |
CH25H ORF Vector (Human) (pORF) |
ORF002309 |
ABM |
1.0 ug DNA |
EUR 95 |
Ch25h ORF Vector (Mouse) (pORF) |
ORF041262 |
ABM |
1.0 ug DNA |
EUR 506 |
Ch25h ORF Vector (Rat) (pORF) |
ORF064919 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant Cholesterol-25-Hydroxylase (CH25H) |
4-RPG357Hu01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O95992
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 16.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Cholesterol-25-Hydroxylase expressed in: E.coli |
CH25H ELISA Kit (Human) (OKCD01912) |
OKCD01912 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Catalyzes the formation of 25-hydroxycholesterol from cholesterol, leading to repress cholesterol biosynthetic enzymes.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 49 pg/mL |
Ch25h ELISA Kit (Mouse) (OKCD01913) |
OKCD01913 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Catalyzes the formation of 25-hydroxycholesterol from cholesterol, leading to repress cholesterol biosynthetic enzymes.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.27 ng/mL |
CH25H ELISA Kit (Human) (OKEH08785) |
OKEH08785 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: This is an intronless gene that is involved in cholesterol and lipid metabolism. The encoded protein is a membrane protein and contains clusters of histidine residues essential for catalytic activity. Unlike most other sterol hydroxylases, this enzyme is a member of a small family of enzymes that utilize diiron cofactors to catalyze the hydroxylation of hydrophobic substrates.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.068ng/mL |
Human Cholesterol-25-Hydroxylase (CH25H) Protein |
20-abx652239 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
CH25H sgRNA CRISPR Lentivector set (Human) |
K0440801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ch25h sgRNA CRISPR Lentivector set (Rat) |
K6262301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ch25h sgRNA CRISPR Lentivector set (Mouse) |
K3647201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Goat Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E06C1649-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E06C1649-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E06C1649-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E02C1649-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E02C1649-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E02C1649-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E03C1649-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E03C1649-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E03C1649-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E04C1649-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E04C1649-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E04C1649-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E01C1649-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E01C1649-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E01C1649-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E07C1649-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E07C1649-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E07C1649-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E08C1649-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E08C1649-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E08C1649-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E09C1649-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E09C1649-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Cholesterol 25 hydroxylase(CH25H) ELISA kit |
E09C1649-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human CH25H/ Cholesterol 25-hydroxylase ELISA Kit |
E2891Hu |
Sunlong |
1 Kit |
EUR 605 |
Mouse Cholesterol 25- hydroxylase, Ch25h ELISA KIT |
ELI-25459m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Cholesterol 25- hydroxylase, CH25H ELISA KIT |
ELI-34078h |
Lifescience Market |
96 Tests |
EUR 824 |
Porcine Cholesterol 25- hydroxylase, CH25H ELISA KIT |
ELI-50769p |
Lifescience Market |
96 Tests |
EUR 928 |
CH25H sgRNA CRISPR Lentivector (Human) (Target 1) |
K0440802 |
ABM |
1.0 ug DNA |
EUR 154 |
CH25H sgRNA CRISPR Lentivector (Human) (Target 2) |
K0440803 |
ABM |
1.0 ug DNA |
EUR 154 |
Murine cross-reactive non-neutralizing polyclonal IgG1 antibodies induced by influenza vaccine inhibit the cross-protective impact of IgG2 towards heterologous virus in mice.
Annual vaccination towards influenza viruses is essentially the most dependable and environment friendly method to forestall and management annual epidemics and defend from extreme influenza illness. Nevertheless, present cut up influenza vaccines are usually not efficient towards antigenically mismatched (heterologous) strains. To broaden the protecting spectrum of influenza vaccines, adjuvants that may induce cross-reactive antibodies with cross-protection through Fc-mediated effector capabilities are urgently sought.
Though IgG2 antibodies are usually extra environment friendly than IgG1 antibodies in Fc-mediated effector capabilities, it isn’t but clear which IgG isotypes present superior cross-protection towards heterologous strains. It additionally stays unclear whether or not these IgG isotypes intervene with one another’s protecting results. Right here, we discovered that influenza cut up vaccine adjuvanted with aluminum salts, which predominantly induce cross-reactive IgG1, didn’t confer cross-protection towards heterologous virus problem in mice.
In distinction, cut up vaccine adjuvanted with CpG oligodeoxynucleotides, which predominantly induce cross-reactive IgG2, confirmed cross-protection by means of the interplay of cross-reactive non-neutralizing IgG2 and alveolar macrophages, indicating the significance of cross-reactive non-neutralizing IgG2 for cross-protection.
Moreover, through the use of serum samples from immunized mice and remoted polyclonal antibodies, we present that vaccine-induced cross-reactive non-neutralizing IgG1 suppress the cross-protective results of IgG2 by competitively inhibiting the binding of IgG2 to virus.
Thus, we display the brand new idea that cross-reactive IgG1 could intervene with the potential for cross-protection of influenza vaccine. We suggest that adjuvants that selectively induce virus-specific IgG2 in mice, reminiscent of CpG oligodeoxynucleotides, are optimum for heterologous safety.
Significance Present influenza vaccines are usually efficient towards extremely related virus strains by inducing neutralizing antibodies.
Nevertheless, these antibodies fail to neutralize antigenically mismatched (heterologous) strains and due to this fact present restricted safety towards them. Efforts are being made to develop vaccines with cross-protective means that will defend broadly towards heterologous strains, as a result of the mismatch between predicted and epidemic strains can’t all the time be averted, leading to low vaccine efficacy.
Right here we present that non-neutralizing IgG2 antibodies induced by an optimum adjuvant play a vital position in cross-protection towards heterologous virus problem in mice. Moreover, non-neutralizing polyclonal IgG1 suppressed the cross-protective results of non-neutralizing polyclonal IgG2 by competitively blocking the binding of IgG2 to its antigen.
These knowledge shed new mild on the significance of IgG isotypes and the choice of applicable adjuvants for the event of common influenza vaccines. Moreover, our findings are relevant to the rational design of vaccines towards different pathogens.
Sulfhydrylated graphene-encapsulated iron nanoparticles straight aminated with polyethylenimine: a novel magnetic nanoplatform for bioconjugation of gamma globulins and polyclonal antibodies.
This examine presents for the primary time the direct amination of graphene-encapsulated iron nanoparticles (GEINs) with polyethylenimine (PEI) through radical-type response. This work describes the primary instance of a direct addition of N-centered radical species onto the graphene layer.
The pristine PEI and the PEI hooked up to GEINs have additionally been derivatized to introduce sulfhydryl functionalities. The proposed two-step protocol constitutes a novel, versatile and low value methodology for the synthesis of polymer derivatives embellished with SH moieties.
The derivatives of pristine polyethylenimine have been analyzed via spectroscopic strategies (NMR and IR), whereas the obtained carbon supplies have been studied by thermogravimetry, infrared spectroscopy, dynamic mild scattering, and transmission electron microscopy.
Lastly, the concomitant a part of this work centered on the bioconjugation sort reactions of assorted biocompounds, together with bovine gamma-globulins and human polyclonal antibodies of sophistication IgG, with the as-obtained sulfhydrylated GEINs-PEI nanoplatform. The presence of immobilized molecules was confirmed by thermogravimetry, protein and fluorescence assays in addition to confocal microscopy pictures.
Rabbit Polyclonal antibody Anti-CRBN |
Anti-CRBN |
ImmunoStep |
50 µg |
EUR 349 |
Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit |
DLR-NET1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuroepithelial Cell Transforming Gene 1 (NET1) in samples from tissue homogenates or other biological fluids. |
Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit |
DLR-NET1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuroepithelial Cell Transforming Gene 1 (NET1) in samples from tissue homogenates or other biological fluids. |
Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit |
RD-NET1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit |
RD-NET1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit |
RDR-NET1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit |
RDR-NET1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
NET1 antibody |
70R-3139 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NET1 antibody raised against the N terminal of NET1 |
NET1 antibody |
70R-3140 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NET1 antibody raised against the middle region of NET1 |
NET1 antibody |
38218-100ul |
SAB |
100ul |
EUR 252 |
NET1 antibody |
10R-1416 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal NET1 antibody |
NET1 antibody |
70R-18846 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NET1 antibody |
NET1 antibody |
70R-10628 |
Fitzgerald |
1 ml |
EUR 693 |
Description: Affinity purified Chicken polyclonal NET1 antibody |
NET1 Antibody |
DF6345 |
Affbiotech |
200ul |
EUR 304 |
Description: NET1 Antibody detects endogenous levels of total NET1. |
NET1 Antibody |
1-CSB-PA768775LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
NET1 Antibody |
1-CSB-PA015714GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA |
NET1 Antibody |
CSB-PA015714KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
NET1 Antibody |
CSB-PA015714KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
NET1 Conjugated Antibody |
C38218 |
SAB |
100ul |
EUR 397 |
NET1 Polyclonal Antibody |
A55443 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Polyclonal Goat Anti-NET1 / ARHGEF8 (Internal) Antibody |
APG00217G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-NET1 / ARHGEF8 (Internal) . This antibody is tested and proven to work in the following applications: |
NET1 siRNA |
20-abx925749 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NET1 siRNA |
20-abx925750 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Polyclonal NET1 Antibody (Internal) |
APR02019G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NET1 (Internal). This antibody is tested and proven to work in the following applications: |
Polyclonal NET1 Antibody (Internal) |
APG01002G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NET1 (Internal). This antibody is tested and proven to work in the following applications: |
NET1 Antibody, HRP conjugated |
1-CSB-PA768775LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NET1 Antibody, FITC conjugated |
1-CSB-PA768775LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NET1 Antibody, Biotin conjugated |
1-CSB-PA768775LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Polyclonal Goat Anti-NET1 / ARHGEF8 (C Terminus) Antibody |
APG00216G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-NET1 / ARHGEF8 (C Terminus) . This antibody is tested and proven to work in the following applications: |
Polyclonal Goat anti-GST α-form |
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST μ-form |
GST-ANTI-2 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST p-form |
GST-ANTI-3 |
Detroit R&D |
50 uL |
EUR 280 |
NET1 Rabbit pAb |
A1213-100ul |
Abclonal |
100 ul |
EUR 308 |
NET1 Rabbit pAb |
A1213-200ul |
Abclonal |
200 ul |
EUR 459 |
NET1 Rabbit pAb |
A1213-20ul |
Abclonal |
20 ul |
EUR 183 |
NET1 Rabbit pAb |
A1213-50ul |
Abclonal |
50 ul |
EUR 223 |
NET1 Blocking Peptide |
33R-1273 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NQO1 antibody, catalog no. 70R-10257 |
NET1 Blocking Peptide |
33R-7919 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NET1 antibody, catalog no. 70R-3139 |
NET1 Blocking Peptide |
DF6345-BP |
Affbiotech |
1mg |
EUR 195 |
NET1 cloning plasmid |
CSB-CL768775HU1-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1629
- Sequence: atggtggcacatgatgagactggaggtctcctacctattaaaaggaccatacgagtcctagatgtcaataaccagtccttcagagaacaagaggagccaagcaataaaagagttcgacctctggctcgtgtcacgtccttggcaaatttaatctctcctgtaagaaatggagctg
- Show more
|
Description: A cloning plasmid for the NET1 gene. |
NET1 cloning plasmid |
CSB-CL768775HU2-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1791
- Sequence: atggagcccgagctggcggctcagaagcagcctcgaccgcggaggcgaagccgccgggcctctgggctcagcacggagggagcgacggggccttcggccgacacctccgggtcggagctggacgggagatgttcccttcggagaggcagctccttcacattcttaacacctggcc
- Show more
|
Description: A cloning plasmid for the NET1 gene. |
Polyclonal NET1 Antibody (C-Terminus) |
APR02020G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NET1 (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal NET1 Antibody (C-Terminus) |
APG01001G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NET1 (C-Terminus). This antibody is tested and proven to work in the following applications: |
NET1 Polyclonal Antibody, HRP Conjugated |
A55444 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
NET1 Polyclonal Antibody, FITC Conjugated |
A55445 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
NET1 Polyclonal Antibody, Biotin Conjugated |
A55446 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Mouse NET1 shRNA Plasmid |
20-abx974710 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NET1 shRNA Plasmid |
20-abx956957 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NET1 Recombinant Protein (Human) |
RP021076 |
ABM |
100 ug |
Ask for price |
NET1 Recombinant Protein (Human) |
RP021079 |
ABM |
100 ug |
Ask for price |
NET1 Recombinant Protein (Rat) |
RP213701 |
ABM |
100 ug |
Ask for price |
NET1 Recombinant Protein (Mouse) |
RP153716 |
ABM |
100 ug |
Ask for price |
NET1 Recombinant Protein (Mouse) |
RP153719 |
ABM |
100 ug |
Ask for price |
Neuroepithelial Cell Transforming Gene 1 (NET1) Antibody |
abx117067-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Neuroepithelial Cell Transforming Gene 1 (NET1) Antibody |
20-abx001125 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Neuroepithelial Cell Transforming Gene 1 (NET1) Antibody |
abx029492-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Neuroepithelial Cell Transforming Gene 1 (NET1) Antibody |
abx029492-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Neuroepithelial Cell Transforming Gene 1 (NET1) Antibody |
20-abx173761 |
Abbexa |
|
|
|