Goat Polyclonal Antibody Against the Sex Determining Region Y to Separate X- and Y-Chromosome


Goat Polyclonal Antibody In opposition to the Intercourse Figuring out Area Y to Separate X- and Y-Chromosome Bearing Spermatozoa.


Intercourse choice of sperm by separating X- and Y-chromosome bearing spermatozoa is vital for effectively acquiring the specified intercourse of animal offspring within the livestock trade. The aim of this examine was to provide a goat polyclonal antibody (pAb) towards the bovine Intercourse Figuring out Area Y chromosome (bSRY) to separate female- and male-bearing spermatozoa. To supply a goat polyclonal antibody towards bSRY, a feminine goat was subcutaneously immunized with 27 kDa of recombinant bSRY (rbSRY) protein because the antigen.

The anti-bSRY pAb was purified by ion-exchange chromatography. The purity of the pAb was decided utilizing the SDS-PAGE methodology. The organic exercise of the anti-bSRY pAb was examined utilizing PCR to evaluate the binding affinity of pAb for the bSRY antigen and commercially sexed bull sperm.


The whole quantity of purified anti-bSRY pAb was roughly 650 mg/goat serum (13 mg/mL). Curiously, our knowledge confirmed that the binding affinity of our pAb to the Y bearing was excessive, whereas the binding affinity of that to the X-chromosome bearing sperm was much like the detrimental management. In conclusion, our findings present that the goat anti-SRY pAb particularly binds to Y-chromosome bearing sperm that suggesting its potential use for intercourse choice.





Human Cholesterol-25-Hydroxylase (CH25H) ELISA Kit
RD-CH25H-Hu-48Tests 48 Tests
EUR 521
Human Cholesterol-25-Hydroxylase (CH25H) ELISA Kit
RD-CH25H-Hu-96Tests 96 Tests
EUR 723
Human Cholesterol-25-Hydroxylase (CH25H) ELISA Kit
RDR-CH25H-Hu-48Tests 48 Tests
EUR 544
Human Cholesterol-25-Hydroxylase (CH25H) ELISA Kit
RDR-CH25H-Hu-96Tests 96 Tests
EUR 756
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
Anti-CH25H (1G8)
YF-MA16625 100 ug
EUR 363
Description: Mouse monoclonal to CH25H
CH25H Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CH25H. Recognizes CH25H from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Ch25h/ Rat Ch25h ELISA Kit
ELI-33482r 96 Tests
EUR 886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CH25H Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CH25H. Recognizes CH25H from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CH25H Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CH25H. Recognizes CH25H from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CH25H Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CH25H. Recognizes CH25H from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280
CH25H cloning plasmid
CSB-CL005307HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 819
  • Sequence: atgagctgccacaactgctccgacccccaggtcctttgcagctccgggcagctgttcctgcagcccctctgggaccacctgaggagctgggaggccctcctacagtcgcccttcttcccggtcatcttctccatcaccacatacgtgggcttttgcctgcccttcgtggtcctgga
  • Show more
Description: A cloning plasmid for the CH25H gene.
CH25H cloning plasmid
CSB-CL005307HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 819
  • Sequence: atgagctgccacaactgctccgacccccaggtcctttgcagctccgggcagctcttcctgcagcccctctgggaccacctgaggagctgggaggccctcctacagtcgcccttcttcccggtcatcttctccatcaccacatacgtgggcttttgcctgcccttcgtggtcctgga
  • Show more
Description: A cloning plasmid for the CH25H gene.
Cholesterol-25-Hydroxylase (CH25H) Antibody
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Cholesterol 25-Hydroxylase (CH25H) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Cholesterol-25-Hydroxylase (CH25H) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Cholesterol 25-Hydroxylase (CH25H) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Cholesterol 25-Hydroxylase (CH25H) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Cholesterol 25-Hydroxylase (CH25H) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rat CH25H shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
EF004749 96 Tests
EUR 689
Human CH25H shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse CH25H shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CH25H Recombinant Protein (Human)
RP006922 100 ug Ask for price
CH25H Recombinant Protein (Human)
RP006925 100 ug Ask for price
CH25H Recombinant Protein (Rat)
RP194753 100 ug Ask for price
CH25H Recombinant Protein (Mouse)
RP123782 100 ug Ask for price
CH25H (Human) ELISA Kit
E4814-100 96 assay
EUR 784
CH25H ORF Vector (Human) (pORF)
ORF002308 1.0 ug DNA
EUR 95
CH25H ORF Vector (Human) (pORF)
ORF002309 1.0 ug DNA
EUR 95
Ch25h ORF Vector (Mouse) (pORF)
ORF041262 1.0 ug DNA
EUR 506
Ch25h ORF Vector (Rat) (pORF)
ORF064919 1.0 ug DNA
EUR 506
Recombinant Cholesterol-25-Hydroxylase (CH25H)
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O95992
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Cholesterol-25-Hydroxylase expressed in: E.coli
CH25H ELISA Kit (Human) (OKCD01912)
OKCD01912 96 Wells
EUR 831
Description: Description of target: Catalyzes the formation of 25-hydroxycholesterol from cholesterol, leading to repress cholesterol biosynthetic enzymes.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 49 pg/mL
Ch25h ELISA Kit (Mouse) (OKCD01913)
OKCD01913 96 Wells
EUR 857
Description: Description of target: Catalyzes the formation of 25-hydroxycholesterol from cholesterol, leading to repress cholesterol biosynthetic enzymes.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.27 ng/mL
CH25H ELISA Kit (Human) (OKEH08785)
OKEH08785 96 Wells
EUR 896
Description: Description of target: This is an intronless gene that is involved in cholesterol and lipid metabolism. The encoded protein is a membrane protein and contains clusters of histidine residues essential for catalytic activity. Unlike most other sterol hydroxylases, this enzyme is a member of a small family of enzymes that utilize diiron cofactors to catalyze the hydroxylation of hydrophobic substrates.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.068ng/mL
Human Cholesterol-25-Hydroxylase (CH25H) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
CH25H sgRNA CRISPR Lentivector set (Human)
K0440801 3 x 1.0 ug
EUR 339
Ch25h sgRNA CRISPR Lentivector set (Rat)
K6262301 3 x 1.0 ug
EUR 339
Ch25h sgRNA CRISPR Lentivector set (Mouse)
K3647201 3 x 1.0 ug
EUR 339
Goat Cholesterol 25 hydroxylase(CH25H) ELISA kit
E06C1649-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Cholesterol 25 hydroxylase(CH25H) ELISA kit
E06C1649-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Cholesterol 25 hydroxylase(CH25H) ELISA kit
E06C1649-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Cholesterol 25 hydroxylase(CH25H) ELISA kit
E02C1649-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Cholesterol 25 hydroxylase(CH25H) ELISA kit
E02C1649-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Cholesterol 25 hydroxylase(CH25H) ELISA kit
E02C1649-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cholesterol 25 hydroxylase(CH25H) ELISA kit
E03C1649-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cholesterol 25 hydroxylase(CH25H) ELISA kit
E03C1649-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cholesterol 25 hydroxylase(CH25H) ELISA kit
E03C1649-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cholesterol 25 hydroxylase(CH25H) ELISA kit
E04C1649-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cholesterol 25 hydroxylase(CH25H) ELISA kit
E04C1649-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cholesterol 25 hydroxylase(CH25H) ELISA kit
E04C1649-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cholesterol 25 hydroxylase(CH25H) ELISA kit
E01C1649-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cholesterol 25 hydroxylase(CH25H) ELISA kit
E01C1649-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cholesterol 25 hydroxylase(CH25H) ELISA kit
E01C1649-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Cholesterol 25 hydroxylase(CH25H) ELISA kit
E07C1649-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Cholesterol 25 hydroxylase(CH25H) ELISA kit
E07C1649-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Cholesterol 25 hydroxylase(CH25H) ELISA kit
E07C1649-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Cholesterol 25 hydroxylase(CH25H) ELISA kit
E08C1649-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Cholesterol 25 hydroxylase(CH25H) ELISA kit
E08C1649-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Cholesterol 25 hydroxylase(CH25H) ELISA kit
E08C1649-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cholesterol 25 hydroxylase(CH25H) ELISA kit
E09C1649-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cholesterol 25 hydroxylase(CH25H) ELISA kit
E09C1649-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cholesterol 25 hydroxylase(CH25H) ELISA kit
E09C1649-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cholesterol 25 hydroxylase(CH25H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CH25H/ Cholesterol 25-hydroxylase ELISA Kit
E2891Hu 1 Kit
EUR 605
Mouse Cholesterol 25- hydroxylase, Ch25h ELISA KIT
ELI-25459m 96 Tests
EUR 865
Human Cholesterol 25- hydroxylase, CH25H ELISA KIT
ELI-34078h 96 Tests
EUR 824
Porcine Cholesterol 25- hydroxylase, CH25H ELISA KIT
ELI-50769p 96 Tests
EUR 928
CH25H sgRNA CRISPR Lentivector (Human) (Target 1)
K0440802 1.0 ug DNA
EUR 154
CH25H sgRNA CRISPR Lentivector (Human) (Target 2)
K0440803 1.0 ug DNA
EUR 154


Murine cross-reactive non-neutralizing polyclonal IgG1 antibodies induced by influenza vaccine inhibit the cross-protective impact of IgG2 towards heterologous virus in mice.


Annual vaccination towards influenza viruses is essentially the most dependable and environment friendly method to forestall and management annual epidemics and defend from extreme influenza illness. Nevertheless, present cut up influenza vaccines are usually not efficient towards antigenically mismatched (heterologous) strains. To broaden the protecting spectrum of influenza vaccines, adjuvants that may induce cross-reactive antibodies with cross-protection through Fc-mediated effector capabilities are urgently sought.

Though IgG2 antibodies are usually extra environment friendly than IgG1 antibodies in Fc-mediated effector capabilities, it isn’t but clear which IgG isotypes present superior cross-protection towards heterologous strains. It additionally stays unclear whether or not these IgG isotypes intervene with one another’s protecting results. Right here, we discovered that influenza cut up vaccine adjuvanted with aluminum salts, which predominantly induce cross-reactive IgG1, didn’t confer cross-protection towards heterologous virus problem in mice.

In distinction, cut up vaccine adjuvanted with CpG oligodeoxynucleotides, which predominantly induce cross-reactive IgG2, confirmed cross-protection by means of the interplay of cross-reactive non-neutralizing IgG2 and alveolar macrophages, indicating the significance of cross-reactive non-neutralizing IgG2 for cross-protection.

Moreover, through the use of serum samples from immunized mice and remoted polyclonal antibodies, we present that vaccine-induced cross-reactive non-neutralizing IgG1 suppress the cross-protective results of IgG2 by competitively inhibiting the binding of IgG2 to virus.

Thus, we display the brand new idea that cross-reactive IgG1 could intervene with the potential for cross-protection of influenza vaccine. We suggest that adjuvants that selectively induce virus-specific IgG2 in mice, reminiscent of CpG oligodeoxynucleotides, are optimum for heterologous safety.

Significance Present influenza vaccines are usually efficient towards extremely related virus strains by inducing neutralizing antibodies.

Nevertheless, these antibodies fail to neutralize antigenically mismatched (heterologous) strains and due to this fact present restricted safety towards them. Efforts are being made to develop vaccines with cross-protective means that will defend broadly towards heterologous strains, as a result of the mismatch between predicted and epidemic strains can’t all the time be averted, leading to low vaccine efficacy.

Right here we present that non-neutralizing IgG2 antibodies induced by an optimum adjuvant play a vital position in cross-protection towards heterologous virus problem in mice. Moreover, non-neutralizing polyclonal IgG1 suppressed the cross-protective results of non-neutralizing polyclonal IgG2 by competitively blocking the binding of IgG2 to its antigen.

These knowledge shed new mild on the significance of IgG isotypes and the choice of applicable adjuvants for the event of common influenza vaccines. Moreover, our findings are relevant to the rational design of vaccines towards different pathogens.


Sulfhydrylated graphene-encapsulated iron nanoparticles straight aminated with polyethylenimine: a novel magnetic nanoplatform for bioconjugation of gamma globulins and polyclonal antibodies.


This examine presents for the primary time the direct amination of graphene-encapsulated iron nanoparticles (GEINs) with polyethylenimine (PEI) through radical-type response. This work describes the primary instance of a direct addition of N-centered radical species onto the graphene layer.

The pristine PEI and the PEI hooked up to GEINs have additionally been derivatized to introduce sulfhydryl functionalities. The proposed two-step protocol constitutes a novel, versatile and low value methodology for the synthesis of polymer derivatives embellished with SH moieties.

The derivatives of pristine polyethylenimine have been analyzed via spectroscopic strategies (NMR and IR), whereas the obtained carbon supplies have been studied by thermogravimetry, infrared spectroscopy, dynamic mild scattering, and transmission electron microscopy.

Lastly, the concomitant a part of this work centered on the bioconjugation sort reactions of assorted biocompounds, together with bovine gamma-globulins and human polyclonal antibodies of sophistication IgG, with the as-obtained sulfhydrylated GEINs-PEI nanoplatform. The presence of immobilized molecules was confirmed by thermogravimetry, protein and fluorescence assays in addition to confocal microscopy pictures.

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit
DLR-NET1-Hu-48T 48T
EUR 517
  • Should the Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuroepithelial Cell Transforming Gene 1 (NET1) in samples from tissue homogenates or other biological fluids.
Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit
DLR-NET1-Hu-96T 96T
EUR 673
  • Should the Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuroepithelial Cell Transforming Gene 1 (NET1) in samples from tissue homogenates or other biological fluids.
Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit
RD-NET1-Hu-48Tests 48 Tests
EUR 521
Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit
RD-NET1-Hu-96Tests 96 Tests
EUR 723
Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit
RDR-NET1-Hu-48Tests 48 Tests
EUR 544
Human Neuroepithelial Cell Transforming Gene 1 (NET1) ELISA Kit
RDR-NET1-Hu-96Tests 96 Tests
EUR 756
Anti-NET1 / ARHGEF8 (Internal) antibody
STJ70935 100 µg
EUR 359
NET1 antibody
70R-3139 50 ug
EUR 467
Description: Rabbit polyclonal NET1 antibody raised against the N terminal of NET1
NET1 antibody
70R-3140 50 ug
EUR 467
Description: Rabbit polyclonal NET1 antibody raised against the middle region of NET1
NET1 Antibody
ABD6345 100 ug
EUR 438
NET1 antibody
38218-100ul 100ul
EUR 252
NET1 antibody
10R-1416 100 ug
EUR 512
Description: Mouse monoclonal NET1 antibody
NET1 antibody
70R-18846 50 ul
EUR 435
Description: Rabbit polyclonal NET1 antibody
NET1 antibody
70R-10628 1 ml
EUR 693
Description: Affinity purified Chicken polyclonal NET1 antibody
NET1 Antibody
DF6345 200ul
EUR 304
Description: NET1 Antibody detects endogenous levels of total NET1.
NET1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
NET1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA
NET1 Antibody
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
NET1 Antibody
CSB-PA015714KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
Anti-NET1 / ARHGEF8 (C Terminus) antibody
STJ70453 100 µg
EUR 359
NET1 Conjugated Antibody
C38218 100ul
EUR 397
NET1 Polyclonal Antibody
A55443 100 µg
EUR 570.55
Description: reagents widely cited
Polyclonal Goat Anti-NET1 / ARHGEF8 (Internal) Antibody
APG00217G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-NET1 / ARHGEF8 (Internal) . This antibody is tested and proven to work in the following applications:
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Polyclonal NET1 Antibody (Internal)
APR02019G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NET1 (Internal). This antibody is tested and proven to work in the following applications:
Polyclonal NET1 Antibody (Internal)
APG01002G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NET1 (Internal). This antibody is tested and proven to work in the following applications:
NET1 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
NET1 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
NET1 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NET1. Recognizes NET1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal Goat Anti-NET1 / ARHGEF8 (C Terminus) Antibody
APG00216G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-NET1 / ARHGEF8 (C Terminus) . This antibody is tested and proven to work in the following applications:
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280
NET1 Rabbit pAb
A1213-100ul 100 ul
EUR 308
NET1 Rabbit pAb
A1213-200ul 200 ul
EUR 459
NET1 Rabbit pAb
A1213-20ul 20 ul
EUR 183
NET1 Rabbit pAb
A1213-50ul 50 ul
EUR 223
NET1 Blocking Peptide
33R-1273 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NQO1 antibody, catalog no. 70R-10257
NET1 Blocking Peptide
33R-7919 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NET1 antibody, catalog no. 70R-3139
NET1 Blocking Peptide
DF6345-BP 1mg
EUR 195
NET1 cloning plasmid
CSB-CL768775HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1629
  • Sequence: atggtggcacatgatgagactggaggtctcctacctattaaaaggaccatacgagtcctagatgtcaataaccagtccttcagagaacaagaggagccaagcaataaaagagttcgacctctggctcgtgtcacgtccttggcaaatttaatctctcctgtaagaaatggagctg
  • Show more
Description: A cloning plasmid for the NET1 gene.
NET1 cloning plasmid
CSB-CL768775HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1791
  • Sequence: atggagcccgagctggcggctcagaagcagcctcgaccgcggaggcgaagccgccgggcctctgggctcagcacggagggagcgacggggccttcggccgacacctccgggtcggagctggacgggagatgttcccttcggagaggcagctccttcacattcttaacacctggcc
  • Show more
Description: A cloning plasmid for the NET1 gene.
PVT13853 2 ug
EUR 391
Polyclonal NET1 Antibody (C-Terminus)
APR02020G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NET1 (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal NET1 Antibody (C-Terminus)
APG01001G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NET1 (C-Terminus). This antibody is tested and proven to work in the following applications:
NET1 Polyclonal Antibody, HRP Conjugated
A55444 100 µg
EUR 570.55
Description: Ask the seller for details
NET1 Polyclonal Antibody, FITC Conjugated
A55445 100 µg
EUR 570.55
Description: The best epigenetics products
NET1 Polyclonal Antibody, Biotin Conjugated
A55446 100 µg
EUR 570.55
Description: kits suitable for this type of research
Mouse NET1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-11655h 96 Tests
EUR 824
EF001180 96 Tests
EUR 689
Mouse Net1 ELISA KIT
ELI-34227m 96 Tests
EUR 865
Human NET1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
NET1 Recombinant Protein (Human)
RP021076 100 ug Ask for price
NET1 Recombinant Protein (Human)
RP021079 100 ug Ask for price
NET1 Recombinant Protein (Rat)
RP213701 100 ug Ask for price
NET1 Recombinant Protein (Mouse)
RP153716 100 ug Ask for price
NET1 Recombinant Protein (Mouse)
RP153719 100 ug Ask for price
Neuroepithelial Cell Transforming Gene 1 (NET1) Antibody
abx117067-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.
Neuroepithelial Cell Transforming Gene 1 (NET1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Neuroepithelial Cell Transforming Gene 1 (NET1) Antibody
abx029492-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Neuroepithelial Cell Transforming Gene 1 (NET1) Antibody
abx029492-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Neuroepithelial Cell Transforming Gene 1 (NET1) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Leave a Reply

Your email address will not be published. Required fields are marked *